-
Url : https://ntm.botalista.community/#/acquisition/edit/9727
Error message : Multiple representations of the same entity [com.botalista.lib.nomenclature.taxon.model.TaxonOnNomenclature#65adf39d-2c6f-…
-
The existing term 6 ripening stage ([PO:0007010](http://purl.obolibrary.org/obo/PO_0007010)) is defined as "Maturation of the fruit. " There are two major problems with this definition: one, it descr…
-
The existing term 5 fruit formation stage ([PO:0007042](http://purl.obolibrary.org/obo/PO_0007042)) is defined as "Formation of the seed-bearing structure after flowering." There are two major problem…
-
sh: line 2: 2474030 Aborted bash -c 'timeout 188s /home/omendivi/.conda/envs/EDTA_1.9.9/bin/blastn -query TE_00071658_INT#LTR/unknown
TCTGGTATCAGAGCAATCATTCCAGGGGATTTGTTCTATGTCTTTTTTT…
-
leaf sheath margin is required to annotate traits from published literature for maize.
Specifically, pubescence of the leaf sheath margin, as separate from pubescence of the leaf sheath. See Flint-…
-
Hi Ian,
Thanks very much for this program - overall it's done a great job of our plastid genome (and it's so fast!).
I have a feature request, if possible. I noticed that for one of our genes, t…
-
@rosiealice and I have been discussing the cost of bark thickness in regards to fire resistance/tolerance. Thicker bark trees have a greater resistance to cambial damage by fire than thinner bark tree…
-
Hi Stephen,
We have a problem here, which has been seen in other posts, but we still don't know how to solve it for our own situation. Here are my files and error prompts.
my treefile:
[TPSa-bo…
-
Hello!Chenxi,@c-zhou
When I run the code
`syncasm -k 1001 -c 100 -t 48 -o green green.fastq`
I got a error:
![6b87038b96b0c9a89580983860337bf](https://github.com/c-zhou/oatk/assets/55218372/fd8c…
-
@alinazeng I am looking at issue #10 .... to help figure what models to run. One big question is how much inference we have to fit garden versus species. Can you make a table of species (row) and gard…