-
After the removal of the position markers (#1464) we decided to evaluate how to make the sequence viewer more user friendly. On strategy could be to adopt the uniprot way of showing sequences. But its…
-
### the issue
in my hands, diamond blastx doesn't always return the highest scoring hit with the `-k 1` flag set.
### background
When using DIAMOND for searching illumina read datasets for matc…
-
Hi there,
Thanks for sharing colabfold. It is greatly appreciated.
we followed the exact step on the github using 'Running locally'. we have a virtual machine with 6cCPUs, 112 RAM, and 1 GPU, and a…
-
## Expected Behavior
k-mer similarity threshold: 145
Starting prefiltering scores calculation (step 1 of 1)
Query db start 1 to 469186
Target db start 1 to 579233
[=============================…
-
```
We need to be able to search for text in the current window (e.g. the
current chapter, dictionary entry, ...). Search should use a standard
highlighted incremental search and key sequence (scroll…
-
### Please check that this issue hasn't been reported before.
- [X] I searched previous [Bug Reports](https://github.com/axolotl-ai-cloud/axolotl/labels/bug) didn't find any similar reports.
### Exp…
-
Search for shRNA sequence GTGAAGAATGTGACAAAGTTT finds two observations, but from the search page it is not possible to go to shRNA page https://ctd2-dashboard.nci.nih.gov/dashboard/#rna/gtgaagaatgtgac…
-
### Is there an existing issue for this?
- [X] I have searched the existing issues
### Describe the bug
Stateful reconnect requires that both client and server calculate the same sequence Id so whe…
-
### Is there an existing issue for this?
- [X] I have searched the existing issues
### Current Behavior
`encrypt_selection` does this:
```python
selection_description_hash = selection_description…
-
### What happened?
**Context**
- Python Pulumi project
- Creates VPC + EKS using Crosswalk
- Creates Managed Node Groups w/ Launch Templates
The motivation here is to set capacity reservations in t…
farra updated
2 weeks ago