search

BenLangmead / bowtie2

A fast and sensitive gapped read aligner
GNU General Public License v3.0
658 stars 158 forks source link

bowtie2-build runs without error but without constructing .rev files #194

Open AnnaSOFI opened 6 years ago

AnnaSOFI commented 6 years ago

Hi,

I have just started learning bowtie2. I encountered a problem with database indexing with bowtie2-build command: indexing runs through but the output doesn't have .rev files, thus preventing me from doing alignments to the particular database. The db file to be indexed is a FASTA file, that is a collection of bacterial genomes. Previously I have successfully indexed and aligned to a db of the same kind (merged fasta files), so now I have no clue what is wrong with the setting or what is going on. I get the 4 other files in reasonable time, although multiple memory-usage test were performed by the software before passing.

I could not find any help online regarding this question. I wonder what I'm doing wrong?

BRs,

Anna

ch4rr0 commented 6 years ago

Would it be possible to share the FASTA?

AnnaSOFI commented 6 years ago

Hi,

The FASTA file is too big to post here, but it has been downloaded from here:

https://www.hmpdacc.org/hmp/catalog/grid.php?dataset=genomic&hmp_isolation_body_site=gastrointestinal_tract

Edit. I could also send the file if this is more convenient?

Anna

whidbeyc commented 6 years ago

Hi, I'm having a very similar problem trying to run bowtie2-build on two different FASTAs (one from metaphlan2's marker database and another that was built from chocophlan). Was there ever a solution found to this? I'm not actually getting an error message, but I think its stopping before it actually finishing the index (see below for the output). This is on version 2.3.4.1, I used bioconda to install.

INFO: Command: bowtie2-build-s --wrapper basic-0 -f Humann2Test/A1HF_humann2_temp/A1HF_custom_chocophlan_database.ffn Humann2Test/A1HF_humann2_temp/A1HF_bowtie2_index
Settings:
  Output files: "Humann2Test/A1HF_humann2_temp/A1HF_bowtie2_index.*.bt2"
  Line rate: 6 (line is 64 bytes)
  Lines per side: 1 (side is 64 bytes)
  Offset rate: 4 (one in 16)
  FTable chars: 10
  Strings: unpacked
  Max bucket size: default
  Max bucket size, sqrt multiplier: default
  Max bucket size, len divisor: 4
  Difference-cover sample period: 1024
  Endianness: little
  Actual local endianness: little
  Sanity checking: disabled
  Assertions: disabled
  Random seed: 0
  Sizeofs: void*:8, int:4, long:8, size_t:8
Input files DNA, FASTA:
  Humann2Test/A1HF_humann2_temp/A1HF_custom_chocophlan_database.ffn
Building a SMALL index
Reading reference sizes
  Time reading reference sizes: 00:00:00
Calculating joined length
Writing header
Reserving space for joined string
Joining reference sequences
  Time to join reference sequences: 00:00:00
bmax according to bmaxDivN setting: 6990730
Using parameters --bmax 5243048 --dcv 1024
  Doing ahead-of-time memory usage test
  Passed!  Constructing with these parameters: --bmax 5243048 --dcv 1024
Constructing suffix-array element generator

If a solution or workaround was found, I'd be very interested to know. Thanks for your help, Chris

AnnaSOFI commented 6 years ago

Hi,

I did not get official advice on this one, but now it is working. I split my enormous FASTA file into two (8.4GB --> 4.2GB) just yesterday and the indexing seemed now to be working for the first part at least (I did not yet run the alignment but at least the .rev files have appeared after indexing ins complete)! Could you try this approach also? ☺ I think I’m going to align my data against both of the FASTA files and then combine the alignment sam files.

BRs,

Anna Sorjamaa

Anna Sorjamaa, PhD student Research Group of Docent Justus Reunanen Biocenter Oulu / Cancer Research and Translational Medicine Research Unit University of Oulu Aapistie 5, P.O. box 5281 90014 University of Oulu, Finland Tel: +35845 879 0354 Email: anna.sorjamaa@oulu.fimailto:anna.sorjamaa@oulu.fi

From: whidbeyc notifications@github.com Sent: Tuesday, July 3, 2018 7:49 AM To: BenLangmead/bowtie2 bowtie2@noreply.github.com Cc: Anna Sorjamaa anna.sorjamaa@oulu.fi; Author author@noreply.github.com Subject: Re: [BenLangmead/bowtie2] bowtie2-build runs without error but without constructing .rev files (#194)

Hi, I'm having a very similar problem trying to run bowtie2-build on two different FASTAs (one from metaphlan2's marker database and another that was built from chocophlan). Was there ever a solution found to this? I'm not actually getting an error message, but I think its stopping before it actually finishing the index (see below for the output). This is on version 2.3.4.1, I used bioconda to install.

INFO: Command: bowtie2-build-s --wrapper basic-0 -f Humann2Test/A1HF_humann2_temp/A1HF_custom_chocophlan_database.ffn Humann2Test/A1HF_humann2_temp/A1HF_bowtie2_index

Settings:

Output files: "Humann2Test/A1HF_humann2_temp/A1HF_bowtie2_index.*.bt2"

Line rate: 6 (line is 64 bytes)

Lines per side: 1 (side is 64 bytes)

Offset rate: 4 (one in 16)

FTable chars: 10

Strings: unpacked

Max bucket size: default

Max bucket size, sqrt multiplier: default

Max bucket size, len divisor: 4

Difference-cover sample period: 1024

Endianness: little

Actual local endianness: little

Sanity checking: disabled

Assertions: disabled

Random seed: 0

Sizeofs: void*:8, int:4, long:8, size_t:8

Input files DNA, FASTA:

Humann2Test/A1HF_humann2_temp/A1HF_custom_chocophlan_database.ffn

Building a SMALL index

Reading reference sizes

Time reading reference sizes: 00:00:00

Calculating joined length

Writing header

Reserving space for joined string

Joining reference sequences

Time to join reference sequences: 00:00:00

bmax according to bmaxDivN setting: 6990730

Using parameters --bmax 5243048 --dcv 1024

Doing ahead-of-time memory usage test

Passed! Constructing with these parameters: --bmax 5243048 --dcv 1024

Constructing suffix-array element generator

If a solution or workaround was found, I'd be very interested to know. Thanks for your help, Chris

— You are receiving this because you authored the thread. Reply to this email directly, view it on GitHubhttps://github.com/BenLangmead/bowtie2/issues/194#issuecomment-402012159, or mute the threadhttps://github.com/notifications/unsubscribe-auth/AmuBYw-mctGb1StfhKlzjICmUM4hFcOqks5uCvetgaJpZM4U3y1H.

lcstewart commented 6 years ago

Hi, I'm having exactly this problem as well - I installed bowtie2 automatically as part of humann2 (version 2.3.4.1), and bowtie2-build will not build .rev.bt2 files from any fasta file I give it, including as part of the MetaPhlAn pipeline indexing the database, but doesn't throw any errors either. It also produces a .2.bt2 file of 0kb, and (for the failed MetaPhlAn database index, where I have a comparison) the other files are smaller than the correctly-indexed database files provided by the makers of that software.

Really keen to figure out if this is a bowtie problem, a server problem, a data problem, or something else!

This is the output I get when I try:

Settings: Output files: "04_MAPPING/contigs.*.bt2" Line rate: 6 (line is 64 bytes) Lines per side: 1 (side is 64 bytes) Offset rate: 4 (one in 16) FTable chars: 10 Strings: unpacked Max bucket size: default Max bucket size, sqrt multiplier: default Max bucket size, len divisor: 4 Difference-cover sample period: 1024 Endianness: little Actual local endianness: little Sanity checking: disabled Assertions: disabled Random seed: 0 Sizeofs: void*:8, int:4, long:8, size_t:8 Input files DNA, FASTA: 03_CONTIGS/contigs.fa Building a SMALL index Reading reference sizes Time reading reference sizes: 00:00:01 Calculating joined length Writing header Reserving space for joined string Joining reference sequences Time to join reference sequences: 00:00:01 bmax according to bmaxDivN setting: 17568529 Using parameters --bmax 13176397 --dcv 1024 Doing ahead-of-time memory usage test Passed! Constructing with these parameters: --bmax 13176397 --dcv 1024 Constructing suffix-array element generator

ch4rr0 commented 6 years ago

I have already begun looking into this. I will update this thread as soon as I have more information.

lcstewart commented 6 years ago

Quick update: I installed versions 2.2.4 and 2.3.0 in conda environments and tried indexing the same file. Version 2.2.4 created all 6 output files without a problem; version 2.3.0 stopped at the same point as 2.3.4.1 and created the same 4 too-small files, but gave an error Segmentation fault (core dumped) when it did.

ch4rr0 commented 6 years ago

@whidbeyc -- can you share your command line? How big is your index? @AnnaSOFI -- I am not able to access the files on the website you provided. Would it be possible to share the link some other way? Maybe a dropbox link?

bbsunchen commented 6 years ago

Same problem here. I install bowtie2 2.3.4.1 with conda. Build the index of a fungi genome with no errors. The fungi genome is ~10^7 bp. The command I used: bowtie2-build -f fungi.fa fungi_bt2 bowtie2 --local -x fungi_bt2 -f -U contigs.fasta -S bowtie.contigs.fungi.sam -p 1

The error I got:

Could not open index file fungi_bt2.rev.1.bt2
Could not open index file fungi_bt2.rev.2.bt2
Segmentation fault (core dumped)
(ERR): bowtie2-align exited with value 139
uribe-convers commented 6 years ago

Same here! I'm trying to build an index from a fasta file that contains ~360,000 contigs (the file size is 194Mb). I'm using bowtie2 version 2.3.4.1 installed from conda (conda install --yes -c bioconda bowtie2=2.3.4.1) with the following command: bowtie2-build final.contigs.fa contig_index .

The program runs with no errors and finishes quickly but generates only four files (contig_index.1.bt2 [5.5Mb], contig_index.2.bt2 [0Mb], contig_index.3.bt2 [3.1Mb], and contig_index.4.bt2 [45Mb]), but no .rev1.bt2 or .rev2.bt2 files.

Here is the output I get when I try to build the indices:

Settings:
  Output files: "contig_index.*.bt2"
  Line rate: 6 (line is 64 bytes)
  Lines per side: 1 (side is 64 bytes)
  Offset rate: 4 (one in 16)
  FTable chars: 10
  Strings: unpacked
  Max bucket size: default
  Max bucket size, sqrt multiplier: default
  Max bucket size, len divisor: 4
  Difference-cover sample period: 1024
  Endianness: little
  Actual local endianness: little
  Sanity checking: disabled
  Assertions: disabled
  Random seed: 0
  Sizeofs: void*:8, int:4, long:8, size_t:8
Input files DNA, FASTA:
  /home/ubuntu/output_169_subset/final.contigs.fa
Building a SMALL index
Reading reference sizes
  Time reading reference sizes: 00:00:02
Calculating joined length
Writing header
Reserving space for joined string
Joining reference sequences
  Time to join reference sequences: 00:00:01
bmax according to bmaxDivN setting: 46852187
Using parameters --bmax 35139141 --dcv 1024
  Doing ahead-of-time memory usage test
  Passed!  Constructing with these parameters: --bmax 35139141 --dcv 1024
Constructing suffix-array element generator

Any advice? Thanks, Simon

uribe-convers commented 6 years ago

Quick update for people who need a quick fix, installing bowtie2 from the other conda link works (at least the bowtie2-build), although it's version 2.2.6.

Here is the link: conda install -c bioconda/label/broken bowtie2

ch4rr0 commented 6 years ago

I probably should have done this before jumping into debugging code, but I just tried building an index with a conda--installed bowtie2 build and got the same output. This issue seems to be isolated to the conda build of bowtie2 as evidenced below:

Conda:

root@a50a2aa0a1ff:/bowtie2# bowtie2-build example/reference/lambda_virus.fa out
Settings:
  Output files: "out.*.bt2"
  Line rate: 6 (line is 64 bytes)
  Lines per side: 1 (side is 64 bytes)
  Offset rate: 4 (one in 16)
  FTable chars: 10
  Strings: unpacked
  Max bucket size: default
  Max bucket size, sqrt multiplier: default
  Max bucket size, len divisor: 4
  Difference-cover sample period: 1024
  Endianness: little
  Actual local endianness: little
  Sanity checking: disabled
  Assertions: disabled
  Random seed: 0
  Sizeofs: void*:8, int:4, long:8, size_t:8
Input files DNA, FASTA:
  example/reference/lambda_virus.fa
Building a SMALL index
Reading reference sizes
  Time reading reference sizes: 00:00:00
Calculating joined length
Writing header
Reserving space for joined string
Joining reference sequences
  Time to join reference sequences: 00:00:00
bmax according to bmaxDivN setting: 12125
Using parameters --bmax 9094 --dcv 1024
  Doing ahead-of-time memory usage test
  Passed!  Constructing with these parameters: --bmax 9094 --dcv 1024
Constructing suffix-array element generator
root@a50a2aa0a1ff:/bowtie2# ls out*
out.1.bt2  out.2.bt2  out.3.bt2  out.4.bt2

Local build:

root@a50a2aa0a1ff:/bowtie2# ./bowtie2-build example/reference/lambda_virus.fa out
Settings:
  Output files: "out.*.bt2"
  Line rate: 6 (line is 64 bytes)
  Lines per side: 1 (side is 64 bytes)
  Offset rate: 4 (one in 16)
  FTable chars: 10
  Strings: unpacked
  Max bucket size: default
  Max bucket size, sqrt multiplier: default
  Max bucket size, len divisor: 4
  Difference-cover sample period: 1024
  Endianness: little
  Actual local endianness: little
  Sanity checking: disabled
  Assertions: disabled
  Random seed: 0
  Sizeofs: void*:8, int:4, long:8, size_t:8
Input files DNA, FASTA:
  example/reference/lambda_virus.fa
Building a SMALL index
Reading reference sizes
  Time reading reference sizes: 00:00:00
Calculating joined length
Writing header
Reserving space for joined string
Joining reference sequences
  Time to join reference sequences: 00:00:00
bmax according to bmaxDivN setting: 12125
Using parameters --bmax 9094 --dcv 1024
  Doing ahead-of-time memory usage test
  Passed!  Constructing with these parameters: --bmax 9094 --dcv 1024
Constructing suffix-array element generator
Building DifferenceCoverSample
  Building sPrime
  Building sPrimeOrder
  V-Sorting samples
  V-Sorting samples time: 00:00:00
  Allocating rank array
  Ranking v-sort output
  Ranking v-sort output time: 00:00:00
  Invoking Larsson-Sadakane on ranks
  Invoking Larsson-Sadakane on ranks time: 00:00:00
  Sanity-checking and returning
Building samples
Reserving space for 12 sample suffixes
Generating random suffixes
QSorting 12 sample offsets, eliminating duplicates
QSorting sample offsets, eliminating duplicates time: 00:00:00
Multikey QSorting 12 samples
  (Using difference cover)
  Multikey QSorting samples time: 00:00:00
Calculating bucket sizes
Splitting and merging
  Splitting and merging time: 00:00:00
Avg bucket size: 48502 (target: 9093)
Converting suffix-array elements to index image
Allocating ftab, absorbFtab
Entering Ebwt loop
Getting block 1 of 1
  No samples; assembling all-inclusive block
  Sorting block of length 48502 for bucket 1
  (Using difference cover)
  Sorting block time: 00:00:00
Returning block of 48503 for bucket 1
Exited Ebwt loop
fchr[A]: 0
fchr[C]: 12334
fchr[G]: 23696
fchr[T]: 36516
fchr[$]: 48502
Exiting Ebwt::buildToDisk()
Returning from initFromVector
Wrote 4210730 bytes to primary EBWT file: out.1.bt2
Wrote 12132 bytes to secondary EBWT file: out.2.bt2
Re-opening _in1 and _in2 as input streams
Returning from Ebwt constructor
Headers:
    len: 48502
    bwtLen: 48503
    sz: 12126
    bwtSz: 12126
    lineRate: 6
    offRate: 4
    offMask: 0xfffffff0
    ftabChars: 10
    eftabLen: 20
    eftabSz: 80
    ftabLen: 1048577
    ftabSz: 4194308
    offsLen: 3032
    offsSz: 12128
    lineSz: 64
    sideSz: 64
    sideBwtSz: 48
    sideBwtLen: 192
    numSides: 253
    numLines: 253
    ebwtTotLen: 16192
    ebwtTotSz: 16192
    color: 0
    reverse: 0
Total time for call to driver() for forward index: 00:00:00
Reading reference sizes
  Time reading reference sizes: 00:00:00
Calculating joined length
Writing header
Reserving space for joined string
Joining reference sequences
  Time to join reference sequences: 00:00:00
  Time to reverse reference sequence: 00:00:00
bmax according to bmaxDivN setting: 12125
Using parameters --bmax 9094 --dcv 1024
  Doing ahead-of-time memory usage test
  Passed!  Constructing with these parameters: --bmax 9094 --dcv 1024
Constructing suffix-array element generator
Building DifferenceCoverSample
  Building sPrime
  Building sPrimeOrder
  V-Sorting samples
  V-Sorting samples time: 00:00:00
  Allocating rank array
  Ranking v-sort output
  Ranking v-sort output time: 00:00:00
  Invoking Larsson-Sadakane on ranks
  Invoking Larsson-Sadakane on ranks time: 00:00:00
  Sanity-checking and returning
Building samples
Reserving space for 12 sample suffixes
Generating random suffixes
QSorting 12 sample offsets, eliminating duplicates
QSorting sample offsets, eliminating duplicates time: 00:00:00
Multikey QSorting 12 samples
  (Using difference cover)
  Multikey QSorting samples time: 00:00:00
Calculating bucket sizes
Splitting and merging
  Splitting and merging time: 00:00:00
Avg bucket size: 48502 (target: 9093)
Converting suffix-array elements to index image
Allocating ftab, absorbFtab
Entering Ebwt loop
Getting block 1 of 1
  No samples; assembling all-inclusive block
  Sorting block of length 48502 for bucket 1
  (Using difference cover)
  Sorting block time: 00:00:00
Returning block of 48503 for bucket 1
Exited Ebwt loop
fchr[A]: 0
fchr[C]: 12334
fchr[G]: 23696
fchr[T]: 36516
fchr[$]: 48502
Exiting Ebwt::buildToDisk()
Returning from initFromVector
Wrote 4210730 bytes to primary EBWT file: out.rev.1.bt2
Wrote 12132 bytes to secondary EBWT file: out.rev.2.bt2
Re-opening _in1 and _in2 as input streams
Returning from Ebwt constructor
Headers:
    len: 48502
    bwtLen: 48503
    sz: 12126
    bwtSz: 12126
    lineRate: 6
    offRate: 4
    offMask: 0xfffffff0
    ftabChars: 10
    eftabLen: 20
    eftabSz: 80
    ftabLen: 1048577
    ftabSz: 4194308
    offsLen: 3032
    offsSz: 12128
    lineSz: 64
    sideSz: 64
    sideBwtSz: 48
    sideBwtLen: 192
    numSides: 253
    numLines: 253
    ebwtTotLen: 16192
    ebwtTotSz: 16192
    color: 0
    reverse: 1
Total time for backward call to driver() for mirror index: 00:00:00
root@a50a2aa0a1ff:/bowtie2# ls out*
out.1.bt2  out.2.bt2  out.3.bt2  out.4.bt2  out.rev.1.bt2  out.rev.2.bt2  outq.cpp  outq.h
ch4rr0 commented 6 years ago

We do provide pre-built bowtie2 packages. Any objections to trying those?

uribe-convers commented 6 years ago

I’m using bowtie on an instance on AWS and I’ve had problems with pre-built software before. Any chance of fixing the conda built or should I get the source code and try it to build it myself?

Thanks for looking into this!

— <Sent from a mobile device, please excuse any typo>

On Jul 19, 2018, at 18:48, ch4rr0 notifications@github.com wrote:

We do provide pre-built bowtie2 packages. Any objections to trying those?

— You are receiving this because you commented. Reply to this email directly, view it on GitHub, or mute the thread.

ch4rr0 commented 6 years ago

I'll see what I can do with regards to the conda build tomorrow. I will keep you posted.

lcstewart commented 6 years ago

Yeah, my IT department won't grant permissions for installing software myself on our bioinformatics server except through conda or pip, so an updated/working conda install would be very handy.

ch4rr0 commented 6 years ago

I put together a script that works within the conda framework to replace the problematic bowtie2 binaries with ones that work. Here's what it does:

You can find out more about this process here.

Once the package has been build, conda install will output the following

The following NEW packages will be INSTALLED:

    bowtie2: 2.3.4.1-py27h6bb024c_1 local

Proceed ([y]/n)? y

Make sure that the package is to be installed is marked local and not bioconda as seen above

Copy the below script verbatim and save to file e.g. bt2_conda.sh. From the command line execute the script by issuing the command: bash bt2_conda.sh. Let me know if you encounter any issues.

#!/bin/bash

if [[ ! -e `which conda-build` ]]; then
    conda install conda-build
fi

if [[ ! -e `which wget` && ! -e `which curl` ]]; then
    echo "Please make sure that either curl or wget is installed"
    exit 1
fi

function cleanup {
    files_to_remove=`ls /tmp/bowtie2`
    for f in $files_to_remove; do
        echo "Deleting $f"
        rm -f $f
    done
    rm -r /tmp/bowtie2
}

trap cleanup EXIT

mkdir /tmp/bowtie2 && cd /tmp/bowtie2
cat <<EOF > build.sh
#!/bin/bash
LDFLAGS=""
make static-libs && make RELEASE_BUILD=1

binaries="\
bowtie2 \
bowtie2-align-l \
bowtie2-align-s \
bowtie2-build \
bowtie2-build-l \
bowtie2-build-s \
bowtie2-inspect \
bowtie2-inspect-l \
bowtie2-inspect-s \
"
directories="scripts"
pythonfiles="bowtie2-build bowtie2-inspect"

PY3_BUILD="\${PY_VER%.*}"

if [ \$PY3_BUILD -eq 3 ]; then
    for i in \$pythonfiles; do
        2to3 --write \$i
    done
fi

for i in \$binaries; do
    cp \$i \$PREFIX/bin && chmod +x \$PREFIX/bin/\$i
done

for d in \$directories; do
    cp -r \$d \$PREFIX/bin
done
EOF

cat <<EOF > meta.yaml
{% set version = "2.3.4.1" %}

package:
  name: bowtie2
  version: {{ version }}

source:
  url: http://downloads.sourceforge.net/project/bowtie-bio/bowtie2/{{ version }}/bowtie2-{{ version }}-source.zip
  sha256: a1efef603b91ecc11cfdb822087ae00ecf2dd922e03c85eea1ed7f8230c119dc
  patches:
    - bowtie2.patch

build:
  number: 1

requirements:
  build:
    - {{ compiler('cxx') }}
  host:
    - python
  run:
    - python
    - perl

test:
  commands:
    - bowtie2 --help
    - bowtie2-align-l --help
    - bowtie2-align-s --help
    - bowtie2-build --help
    - bowtie2-build-l --help
    - bowtie2-build-s --help
    - bowtie2-inspect --help
    - bowtie2-inspect-l --help
    - bowtie2-inspect-s --help

about:
  home: 'http://bowtie-bio.sourceforge.net/bowtie2/index.shtml'
  license: GPLv3
  summary: Fast and sensitive read alignment

extra:
  identifiers:
    - biotools:bowtie2
    - doi:10.1038/nmeth.1923
EOF

cat <<EOF > bowtie2.patch
--- bowtie2.orig        2017-01-20 19:41:25.706765000 -0500
+++ bowtie2     2017-01-20 16:23:38.574188000 -0500
@@ -38,10 +38,10 @@
  my (\$vol,\$script_path,\$prog);
  \$prog = File::Spec->rel2abs( __FILE__ );

-while (-f \$prog && -l \$prog){
-    my (undef, \$dir, undef) = File::Spec->splitpath(\$prog);
-    \$prog = File::Spec->rel2abs(readlink(\$prog), \$dir);
-}
+#while (-f \$prog && -l \$prog){
+#    my (undef, \$dir, undef) = File::Spec->splitpath(\$prog);
+#    \$prog = File::Spec->rel2abs(readlink(\$prog), \$dir);
+#}

  (\$vol,\$script_path,\$prog)
                  = File::Spec->splitpath(\$prog);
EOF

cd -

conda-build /tmp/bowtie2

if [[ $? -ne 0 ]]; then
    echo "Build failed... exiting"
    exit 1
fi

echo "Build complete... Uninstalling your current bowtie2 runtime."
echo "Would you like to continue? yes/no?"
read ans
case "$ans" in
    yes)
        conda uninstall bowtie2
        ;;
    *)
        echo Exiting...
        exit 1
        ;;
esac
conda install --use-local bowtie2
uribe-convers commented 6 years ago

Thank you so much! I’ll try it tomorrow morning and report back if I have any problems! Simon

microsat2018 commented 6 years ago

I encountered the same problem. The bowtie2-build is 2.3.4.1 from conda. I actually used a very small fasta file

a1 CATGTCCAGCTTCTCTTCAGTACCGCTCACCAGCCTAGGTGGGACCACTGACTGTGAGTC TGCAGTGGCCACCGCCCAGTCTCTGTGTCTCAAGCTCCAAGAGACGGTCACACACTAACC TGCAAGCCAAGGCTGGTGACTTTGACCATCCCTAACGCATGAGTTTTCCATGGAAACCTG GTCGGTGAACCTGACACGAAATTCCCAATTCCCCTTTACTCTGTACTGTGTGGCTGGTGC TCTTGTTTTCGTTCTCTCTCTCTCTCTCTCTCTCTCTCAAGTTGATTCCTCCATGTTGCT TTACAGAGACCTGCCAACTACCCAGGAATGTAAAAGCATTCATAGTATTTGTCTAGTAGA

No the two .rev.*.bt2 files Can anyone help with this issue?

uribe-convers commented 6 years ago

I ended up being able to use the pre-built bowtie2 binary and works well. Get it here: https://sourceforge.net/projects/bowtie-bio/files/bowtie2/2.3.4.1

or from the command line

wget https://sourceforge.net/projects/bowtie-bio/files/bowtie2/2.3.4.1/bowtie2-2.3.4.1-linux-x86_64.zip/download -O bowtie2-2.3.4.1-linux-x86_64.zip
nick-youngblut commented 6 years ago

My research group is having the same (or similar) problem when running bioconda::bowtie2=2.3.4.1 as part of bioconda::humann2=0.11.1. The error always something like:

Building a SMALL index
Index is corrupt: File size for /tmp/global/LLMGP_82144987094/MI-208-H/MI-208-H_humann2_temp/MI-208-H_bowtie2_index.1.bt2 should have been 132894396 but is actually 0.
Index is corrupt: File size for /tmp/global/LLMGP_82144987094/MI-208-H/MI-208-H_humann2_temp/MI-208-H_bowtie2_index.2.bt2 should have been 63736900 but is actually 0.
Please check if there is a problem with the disk or if disk is full.
Error: Encountered internal Bowtie 2 exception (#1)

...and sometimes in the "rev" index files are are zero-sized.

This error seems to happen stochastically for us, and usually only when the I/O load is really heavy. If I rerun the "problematic" samples in isolation (instead of 20-30 parallel humann2 jobs), then they usually work. Maybe it's some sort of file latency issue?

ch4rr0 commented 6 years ago

I recently had a pull request merged that changes the way conda builds bowtie 2. This new build process will be in effect for our most recent release of bowtie 2, v2.3.4.2. The updated build process is identical to the way we build our bowtie 2 binaries for distribution. The resulting binaries will have all dependencies statically linked which should solve what I think has been the root of this issue, the dynamically linked TBB library. Please give this new version a try and let me know if this problem still persists.

ch4rr0 commented 6 years ago

I will be closing this thread. Feel free to reopen if you believe that v2.3.4.2 has not addressed this issue.

domenico-simone commented 5 years ago

Hello,

I am re-opening this thread since I'm not able to get proper index files with either 2.3.3.1 or 2.3.4.1, but I get them with 2.2.9. I am working on a cluster (not through conda). If it matters, the input files contains nearly 1M sequences. The stdout is 

[domeni@r102 new_contig_mappings]$ bowtie2-build thawponds_assembly.fa thawponds_assembly
Settings:
  Output files: "thawponds_assembly.*.bt2"
  Line rate: 6 (line is 64 bytes)
  Lines per side: 1 (side is 64 bytes)
  Offset rate: 4 (one in 16)
  FTable chars: 10
  Strings: unpacked
  Max bucket size: default
  Max bucket size, sqrt multiplier: default
  Max bucket size, len divisor: 4
  Difference-cover sample period: 1024
  Endianness: little
  Actual local endianness: little
  Sanity checking: disabled
  Assertions: disabled
  Random seed: 0
  Sizeofs: void*:8, int:4, long:8, size_t:8
Input files DNA, FASTA:
  thawponds_assembly.fa
Building a SMALL index
Reading reference sizes
  Time reading reference sizes: 00:00:18
Calculating joined length
Writing header
Reserving space for joined string
Joining reference sequences
  Time to join reference sequences: 00:00:10
bmax according to bmaxDivN setting: 569603352
Using parameters --bmax 427202514 --dcv 1024
  Doing ahead-of-time memory usage test
  Passed!  Constructing with these parameters: --bmax 427202514 --dcv 1024
Constructing suffix-array element generator
Building DifferenceCoverSample
  Building sPrime
  Building sPrimeOrder
  V-Sorting samples
  V-Sorting samples time: 00:00:48
  Allocating rank array
  Ranking v-sort output
  Ranking v-sort output time: 00:00:15
  Invoking Larsson-Sadakane on ranks
  Invoking Larsson-Sadakane on ranks time: 00:00:28
  Sanity-checking and returning
Building samples
Reserving space for 12 sample suffixes
Generating random suffixes
QSorting 12 sample offsets, eliminating duplicates
QSorting sample offsets, eliminating duplicates time: 00:00:00
Multikey QSorting 12 samples
  (Using difference cover)
  Multikey QSorting samples time: 00:00:00
Calculating bucket sizes
Splitting and merging
  Splitting and merging time: 00:00:00
Avg bucket size: 2.27841e+09 (target: 427202513)
Converting suffix-array elements to index image
Allocating ftab, absorbFtab
Entering Ebwt loop
Getting block 1 of 1
  No samples; assembling all-inclusive block

and I get all files but the rev ones. I've read the previous messages in this thread, it's not clear to me if I should ask the admins to re-install the previous 2.3.x versions or install 2.3.4.2.

Many thanks,

Domenico

ch4rr0 commented 5 years ago

Hello,

How big is your input file? Are you using one of our pre-built binary packages?

MarieLataretu commented 4 years ago

Hi,

I still have the problem, that bowtie2-build does not create rev files and/or produces segmentation faults. Here are the versions I tested:

ch4rr0 commented 4 years ago

Hello @MarieLataretu ,

Can you please share the FASTA and the command line for the index that you are trying to build? This issue seems to happen sporadically and hence has been difficult to debug.

MarieLataretu commented 4 years ago

Hi,

this is the input fasta (unzipped):

ftp://ftp.ensembl.org/pub/release-92/fasta/mus_musculus/dna/Mus_musculus.GRCm38.dna.primary_assembly.fa.gz

here we add 'chr' to chromosomes as prefix:

sed -r '/^>/ s/>([1-9MXY])/>chr\1/' Mus_musculus.GRCm38.dna.primary_assembly.fa > Mus_musculus.GRCm38.dna.primary_assembly.chr.fa

and this is the command:

mkdir bowtie2-index
nice [/path/to/]bowtie2-build -t 20 /path/to/genome/Mus_musculus.GRCm38.dna.primary_assembly.chr.fa bowtie2-index/Mus_musculus.GRCm38.dna.primary_assembly.chr &> bowtie2-index/bowtie2-build.log

I have the same problem without the prefix and when the fasta file is in the same directory as the output.

ch4rr0 commented 4 years ago

If you have the bowtie2-build-s-debug binary available can you try using it when building the index? I'd also appreciate it if you can save and share the debug output with me.

MarieLataretu commented 4 years ago

Sure!

the command is now:

nice /path/to/bowtie2-build-s-debug -t 20 /path/to/Mus_musculus.GRCm38.dna.primary_assembly.chr.fa bowtie2-index/Mus_musculus.GRCm38.dna.primary_assembly.chr.debug &> bowtie2-index/debug.log

and the resulting log file:

Settings:
  Output files: "bowtie2-index/Mus_musculus.GRCm38.dna.primary_assembly.debug.*.bt2"
  Line rate: 6 (line is 64 bytes)
  Lines per side: 1 (side is 64 bytes)
  Offset rate: 4 (one in 16)
  FTable chars: 20
  Strings: unpacked
  Max bucket size: default
  Max bucket size, sqrt multiplier: default
  Max bucket size, len divisor: 4
  Difference-cover sample period: 1024
  Endianness: little
  Actual local endianness: little
  Sanity checking: disabled
  Assertions: enabled
  Random seed: 0
  Sizeofs: void*:8, int:4, long:8, size_t:8
Input files DNA, FASTA:
  /data/fass1/genomes/Eukaryots/mus_musculus_done/03052018/Mus_musculus.GRCm38.dna.primary_assembly.fa
Building a SMALL index
Reading reference sizes
  Time reading reference sizes: 00:00:47
assert_leq: expected (20) <= (16)
bt2_idx.h:208
bowtie2-build-s-debug: bt2_idx.h:208: bool EbwtParams::repOk() const: Assertion `0' failed.

Only 3 and 4 index files were created (before only the rev files were missing); the running time dropped from > 10 minutes to ~ 1 minute.

Thanks for looking into this!

ch4rr0 commented 4 years ago

I switched to a dedicated Linux box and now am finally able to recreate the issue consistently. Will update this thread if/when I am able to find the cause of this issue. Thank you for your patience.

ch4rr0 commented 4 years ago

Did you pass in -t 20 with the intention of increasing the number of threads? When run in debug mode Bowtie2 will fail on the assertion that ftabChars should be less than or equal to 16, but you passed in the value 20. This also seems to affect the release build as well preventing Bowtie 2 from creating the reverse indexes. Try removing -t 20, as I did, and see if the reverse files get created.

alesanzdro commented 4 years ago

Apparently I had the same error, (Bowtie 2 version 2.3.5) "-rev" files were not generated. Is it possible that the new version has been corrected? I had problems and in the end it seems that I already produced the 6 files.

conda install -c bioconda bowtie2 bowtie2-build --threads 24 $genome $out > out.msg 2> out.err

At the moment it is running well and in parallel.

MarieLataretu commented 4 years ago

Aha, -t 20 --thread 20 does not work, whereas --thread 20 works, as well as no -t and --threads parameters set!

The version is bowtie2-2.3.5.1.

YiJessePi commented 4 years ago

I'm having a similar issue. After using conda I've used pre-built bowtie2 (23.5.1) downloaded from: https://netix.dl.sourceforge.net/project/bowtie-bio/bowtie2/2.3.5.1/bowtie2-2.3.5.1-linux-x86_64.zip unzipped and executed the build command: bowtie2-build ref_db.fa ref_db_packed --threads 2 --large-index --packed The process ends suddenly , without any out of memory or or core-dump message. Settings: Output files: "ref_db_packed.*.bt2l" Line rate: 7 (line is 128 bytes) Lines per side: 1 (side is 128 bytes) Offset rate: 4 (one in 16) FTable chars: 10 Strings: packed Max bucket size: default Max bucket size, sqrt multiplier: default Max bucket size, len divisor: 8 Difference-cover sample period: 1024 Endianness: little Actual local endianness: little Sanity checking: disabled Assertions: disabled Random seed: 0 Sizeofs: void*:8, int:4, long:8, size_t:8 Input files DNA, FASTA: ref_db.fa Building a LARGE index Reading reference sizes Time reading reference sizes: 00:16:12 Calculating joined length Writing header Reserving space for joined string Joining reference sequences Time to join reference sequences: 00:11:35 bmax according to bmaxDivN setting: 17192161509 Using parameters --bmax 12894121132 --dcv 1024 Doing ahead-of-time memory usage test Passed! Constructing with these parameters: --bmax 12894121132 --dcv 1024 --packed Constructing suffix-array element generator Building DifferenceCoverSample Building sPrime Building sPrimeOrder V-Sorting samples V-Sorting samples time: 01:59:07 Allocating rank array Ranking v-sort output Ranking v-sort output time: 00:58:21 Invoking Larsson-Sadakane on ranks Invoking Larsson-Sadakane on ranks time: 01:26:11 Sanity-checking and returning Building samples Reserving space for 22 sample suffixes Generating random suffixes QSorting 22 sample offsets, eliminating duplicates QSorting sample offsets, eliminating duplicates time: 00:00:00 Multikey QSorting 22 samples (Using difference cover) Multikey QSorting samples time: 00:00:00 Calculating bucket sizes Splitting and merging Splitting and merging time: 00:00:00 Split 4, merged 12; iterating... Splitting and merging Splitting and merging time: 00:00:00 Split 3, merged 1; iterating... Splitting and merging Splitting and merging time: 00:00:00 Avg bucket size: 9.82409e+09 (target: 12894121131) Converting suffix-array elements to index image Allocating ftab, absorbFtab Entering Ebwt loop Getting block 1 of 14 Getting block 2 of 14 Reserving size (12894121132) for bucket 1 Reserving size (12894121132) for bucket 2 Calculating Z arrays for bucket 1 Calculating Z arrays for bucket 2 Entering block accumulator loop for bucket 1: Entering block accumulator loop for bucket 2: bucket 1: 10% bucket 2: 10% bucket 1: 20% bucket 2: 20% bucket 1: 30% bucket 2: 30% bucket 1: 40% bucket 2: 40% bucket 1: 50% bucket 2: 50% bucket 1: 60% bucket 2: 60% bucket 1: 70% bucket 2: 70% bucket 1: 80% bucket 1: 90% bucket 2: 80% bucket 1: 100% Sorting block of length 12843066619 for bucket 1 (Using difference cover) bucket 2: 90% bucket 2: 100% Sorting block of length 7007973381 for bucket 2 (Using difference cover) Sorting block time: 06:08:46 Returning block of 7007973382 for bucket 2 Getting block 3 of 14 Reserving size (12894121132) for bucket 3 Calculating Z arrays for bucket 3 Entering block accumulator loop for bucket 3: bucket 3: 10% bucket 3: 20% bucket 3: 30% bucket 3: 40% bucket 3: 50% bucket 3: 60% bucket 3: 70% The genome is pretty big (~100GB) so it might be the issue, but I'm not sure since while tracking the usage (both CPU and RAM) it seems to be OK. Any idea what happening here? (I think it is not a version issue because I tried both 2.4.3 via conda and pre-built 2.3.5.1). Thanks!

ch4rr0 commented 4 years ago

I’m going to publish a beta build today that I think solves this issue. If you can help test the build when it is out that will be appreciated.

ch4rr0 commented 4 years ago

Having some trouble creating the build. Will try again tomorrow.

YiJessePi commented 4 years ago

Thanks. I'll try when it will be ready. Just want to update that it do seems to be (also?) a memory issue. I've logged the memory while running and it seemed to use 100% of memory when it stopped. Is there anything to do except of using --packed and increasing --offset to reduce RAM usage while building the index? Thanks again!

ch4rr0 commented 4 years ago

I don't think there's any other way to decrease the size of index files other than using --packed. You can try using more threads to speed up the process. Your issue seems slightly different from what's being reported here. It seems like bowtie2-build is stopping prematurely as opposed to running to completion and not generating the reverse index. In any event here is a link to the build I created earlier. It's a one-off so I didn't bother uploading to GitHub.

Here's the SHA256 sum incase you want to verify the file's integrity (ignore the version number as I didn't bother updating the VERSION file in the repo).

03d99c3c8b12219422575772b08076cd27c81eff0b4e3f0522fc998456898412  bowtie2-2.3.5.1-linux-x86_64.zip
YiJessePi commented 4 years ago

Thanks! I'll try it once the current index build will finish. It somehow takes two and a half days... It enters the Ebwt loop again and again already 12 times (here is one of the twelve):

Entering Ebwt loop Getting block 1 of 1 No samples; assembling all-inclusive block Ran out of memory; automatically trying more memory-economical parameters. Using parameters --bmax 1089169922 --dcv 4096 Doing ahead-of-time memory usage test Passed! Constructing with these parameters: --bmax 1089169922 --dcv 4096 --packed Constructing suffix-array element generator Building DifferenceCoverSample Building sPrime Building sPrimeOrder V-Sorting samples V-Sorting samples time: 02:28:08 Allocating rank array Ranking v-sort output Ranking v-sort output time: 00:35:30 Invoking Larsson-Sadakane on ranks Invoking Larsson-Sadakane on ranks time: 00:35:52 Sanity-checking and returning Building samples Reserving space for 254 sample suffixes Generating random suffixes QSorting 254 sample offsets, eliminating duplicates QSorting sample offsets, eliminating duplicates time: 00:00:00 Multikey QSorting 254 samples (Using difference cover) Multikey QSorting samples time: 00:00:00 Calculating bucket sizes Splitting and merging Splitting and merging time: 00:00:00 Avg bucket size: 1.37537e+11 (target: 1089169921) Converting suffix-array elements to index image Allocating ftab, absorbFtab Entering Ebwt loop Getting block 1 of 1 No samples; assembling all-inclusive block Ran out of memory; automatically trying more memory-economical parameters. Using parameters --bmax 816877442 --dcv 4096 Doing ahead-of-time memory usage test Passed! Constructing with these parameters: --bmax 816877442 --dcv 4096 --packed Constructing suffix-array element generator Building DifferenceCoverSample Building sPrime Building sPrimeOrder V-Sorting samples V-Sorting samples time: 02:33:43 Allocating rank array Ranking v-sort output Ranking v-sort output time: 00:38:27 Invoking Larsson-Sadakane on ranks Invoking Larsson-Sadakane on ranks time: 00:35:40 Sanity-checking and returning Building samples Reserving space for 338 sample suffixes Generating random suffixes QSorting 338 sample offsets, eliminating duplicates QSorting sample offsets, eliminating duplicates time: 00:00:00 Multikey QSorting 338 samples (Using difference cover) Multikey QSorting samples time: 00:00:00 Calculating bucket sizes Splitting and merging Splitting and merging time: 00:00:00 Avg bucket size: 1.37537e+11 (target: 816877441) Converting suffix-array elements to index image Allocating ftab, absorbFtab

Does it seems to be stucked in infinite loop or it seems normal to you? My best!

MarieLataretu commented 4 years ago

Hi ch4rr0,

-t/--ftabChars arg must not exceed 16
Error: Encountered internal Bowtie 2 exception (#1)

Command:

nice /path/to/bowtie2-2.4.0-beta-linux-x86_64/bowtie2-build-s-debug [-t 20|--threads 20|-t 15 --threads 20] /path/to/Mus_musculus.GRCm38.dna.primary_assembly.chr.fa bowtie2-index/Mus_musculus.GRCm38.dna.primary_assembly.chr.debug
ch4rr0 commented 4 years ago

Thanks for the detailed log. I will look into the issue and get back to you once it's been resolved.

pmdbio commented 4 years ago

I believe I'm having the same problem.

I'm using MacOS Catalina and zsh. I used bowtie2 pre-compiled binaries.

After trying to use bowtie2-build for the first time it generated 4 files, but no .1.bt2 or .rev.1.bt2.

After trying to run the same command in a different folder, I got this:

ltelles@ltelles-mac lambda_virus % ~/Desktop/documents_desktop/bioinformatics/bowtie2-2.3.5.1-macos-x86_64/bowtie2-build ~/Desktop/documents_desktop/bioinformatics/bowtie2-2.3.5.1-macos-x86_6/example/reference/lambda_virus.fa lambda_virus
Settings:
  Output files: "lambda_virus.*.bt2"
  Line rate: 6 (line is 64 bytes)
  Lines per side: 1 (side is 64 bytes)
  Offset rate: 4 (one in 16)
  FTable chars: 10
  Strings: unpacked
  Max bucket size: default
  Max bucket size, sqrt multiplier: default
  Max bucket size, len divisor: 4
  Difference-cover sample period: 1024
  Endianness: little
  Actual local endianness: little
  Sanity checking: disabled
  Assertions: disabled
  Random seed: 0
  Sizeofs: void*:8, int:4, long:8, size_t:8
Input files DNA, FASTA:
  /Users/ltelles/Desktop/documents_desktop/bioinformatics/bowtie2-2.3.5.1-macos-x86_6/example/reference/lambda_virus.fa
Error: could not open /Users/ltelles/Desktop/documents_desktop/bioinformatics/bowtie2-2.3.5.1-macos-x86_6/example/reference/lambda_virus.fa
Total time for call to driver() for forward index: 00:00:00
Error: Encountered internal Bowtie 2 exception (#1)
Command: /Users/ltelles/Desktop/documents_desktop/bioinformatics/bowtie2-2.3.5.1-macos-x86_64/bowtie2-build-s --wrapper basic-0 /Users/ltelles/Desktop/documents_desktop/bioinformatics/bowtie2-2.3.5.1-macos-x86_6/example/reference/lambda_virus.fa lambda_virus

I am sure I used the correct paths for bowtie2-build and for the lambda_virus.fa files.

ch4rr0 commented 4 years ago

@MarieLataretu -- I fixed the issue that was causing this in a recent commit, and confirmed it worked by building the GRCm38 without failure. I have not created a build with that includes this commit, but the issue should only affect bowtie2-build when running in debug mode.

@pmdbio -- You appear to have a typo in your path: missing the 4 after in x86_64. ~/Desktop/documents_desktop/bioinformatics/bowtie2-2.3.5.1-macos-x86_6/example/reference/lambda_virus.fa

@YiJessePi -- For such a large reference, 100GB, it's not unusual for bowtie2-build to take a long time. The output may seem repetitive, but unless bowtie2-build has crashed it's almost guaranteed that it is working on building the index.

pmdbio commented 4 years ago

@ch4rr0 Thanks for spotting that. Indeed it was a typo on the path.

rob123king commented 4 years ago

you just need to set it to produce a large index using the option and not small. it automatically detects and produces a small index sometimes which don't have the rev files but some tools are build to expect a large index or might just be coincidence that worked for me one time

joeltorres96 commented 4 years ago

@ch4rr0 Hi! I hope to help me pls. I´m using the subsystem of Linux in windows10 pro, and I run "Bowtie" by UBUNTU, i downloaded it from Microsoft Store. My problem is this: I stay in Ubuntu:

joeltorres@DESKTOP-EBIAPSJ: ~$ bowtie No index, query, or output file specified! Usage: bowtie [options]* {-1 -2 | --12 | --interleaved | } []

Comma-separated list of files containing upstream mates (or the sequences themselves, if -c is set) paired with mates in Comma-separated list of files containing downstream mates (or the sequences themselves if -c is set) paired with mates in Comma-separated list of files containing Crossbow-style reads. Can be a mixture of paired and unpaired. Specify "-" for stdin. Files with interleaved paired-end FASTQ reads. Comma-separated list of files containing unpaired reads, or the sequences themselves, if -c is set. Specify "-" for stdin. File to write hits to (default: stdout) Input: -q query input files are FASTQ .fq/.fastq (default) -f query input files are (multi-)FASTA .fa/.mfa -F k:,i: query input files are continuous FASTA where reads are substrings (k-mers) extracted from a FASTA file and aligned at offsets 1, 1+i, 1+2i ... end of reference -r query input files are raw one-sequence-per-line -c query sequences given on cmd line (as , ) -C reads and index are in colorspace -Q/--quals QV file(s) corresponding to CSFASTA inputs; use with -f -C --Q1/--Q2 same as -Q, but for mate files 1 and 2 respectively -s/--skip skip the first reads/pairs in the input -u/--qupto stop after first reads/pairs (excl. skipped reads) -5/--trim5 trim bases from 5' (left) end of reads -3/--trim3 trim bases from 3' (right) end of reads --phred33-quals input quals are Phred+33 (default) --phred64-quals input quals are Phred+64 (same as --solexa1.3-quals) --solexa-quals input quals are from GA Pipeline ver. < 1.3 --solexa1.3-quals input quals are from GA Pipeline ver. >= 1.3 --integer-quals qualities are given as space-separated integers (not ASCII) --large-index force usage of a 'large' index, even if a small one is present Alignment: -v report end-to-end hits w/ <=v mismatches; ignore qualities or -n/--seedmms max mismatches in seed (can be 0-3, default: -n 2) -e/--maqerr max sum of mismatch quals across alignment for -n (def: 70) -l/--seedlen seed length for -n (default: 28) --nomaqround disable Maq-like quality rounding for -n (nearest 10 <= 30) -I/--minins minimum insert size for paired-end alignment (default: 0) -X/--maxins maximum insert size for paired-end alignment (default: 250) --fr/--rf/--ff -1, -2 mates align fw/rev, rev/fw, fw/fw (default: --fr) --nofw/--norc do not align to forward/reverse-complement reference strand --maxbts max # backtracks for -n 2/3 (default: 125, 800 for --best) --pairtries max # attempts to find mate for anchor hit (default: 100) -y/--tryhard try hard to find valid alignments, at the expense of speed --chunkmbs max megabytes of RAM for best-first search frames (def: 64) --reads-per-batch # of reads to read from input file at once (default: 16) Reporting: -k report up to good alignments per read (default: 1) -a/--all report all alignments per read (much slower than low -k) -m suppress all alignments if > exist (def: no limit) -M like -m, but reports 1 random hit (MAPQ=0); requires --best --best hits guaranteed best stratum; ties broken by quality --strata hits in sub-optimal strata aren't reported (requires --best) Output: -t/--time print wall-clock time taken by search phases -B/--offbase leftmost ref offset = in bowtie output (default: 0) --quiet print nothing but the alignments --refidx refer to ref. seqs by 0-based index rather than name --al write aligned reads/pairs to file(s) --un write unaligned reads/pairs to file(s) --no-unal suppress SAM records for unaligned reads --max write reads/pairs over -m limit to file(s) --suppress suppresses given columns (comma-delim'ed) in default output --fullref write entire ref name (default: only up to 1st space) Colorspace: --snpphred Phred penalty for SNP when decoding colorspace (def: 30) or --snpfrac approx. fraction of SNP bases (e.g. 0.001); sets --snpphred --col-cseq print aligned colorspace seqs as colors, not decoded bases --col-cqual print original colorspace quals, not decoded quals --col-keepends keep nucleotides at extreme ends of decoded alignment SAM: -S/--sam write hits in SAM format --mapq default mapping quality (MAPQ) to print for SAM alignments --sam-nohead supppress header lines (starting with @) for SAM output --sam-nosq supppress @SQ header lines for SAM output --sam-RG add (usually "lab=value") to @RG line of SAM header Performance: -o/--offrate override offrate of index; must be >= index's offrate -p/--threads number of alignment threads to launch (default: 1) --mm use memory-mapped I/O for index; many 'bowtie's can share --shmem use shared mem for index; many 'bowtie's can share Other: --seed seed for random number generator --verbose verbose output (for debugging) --version print version information and quit -h/--help print this usage message I dont understand, how can i resolve this?? Pls help
joeltorres96 commented 4 years ago

@ch4rr0 Hi! I hope to help me pls. I´m using the subsystem of Linux on windows10 pro, and I dowloaded and run "Bowtie" by UBUNTU, i downloaded UBUNTU from Microsoft Store. My problem is this: I stay in Ubuntu:

joeltorres@DESKTOP-EBIAPSJ: ~$ bowtie No index, query, or output file specified! Usage: bowtie [options]* {-1 -2 | --12 | --interleaved etc...

I dont understand, how can i resolve this? I need your help. I'm new in bioinformatics

jgarces02 commented 4 years ago

Hi there, I also had this problem and I saw this comment on Biostars... I try to use another reference file without Ns nucleotides (i.e., only those coding for transcripts) and the ".rev" files were (in appearance) correctly generated. I hope that helps!

ch4rr0 commented 4 years ago

@joeltorres96 — what command are you trying to run? You provided an example of you running bowtie without any parameters which will result in the usage message getting printed.

  • © Githubissues.
  • Githubissues is a development platform for aggregating issues.