search

BoevaLab / FREEC

Control-FREEC: Copy number and genotype annotation in whole genome and whole exome sequencing data
153 stars 49 forks source link

freec can't extract reads from bam file #137

Open ZYongQi opened 11 months ago

ZYongQi commented 11 months ago

Hi,here is ZY. I want to call CNVs from bam files.My expected output is ''_CNVs'',but something is wrong.

sambamba 1.0.0 by Artem Tarasov and Pjotr Prins (C) 2012-2022 LDC 1.28.1 / DMD v2.098.1 / LLVM12.0.0 / bootstrap LDC - the LLVM D compiler (1.28.1)

..finished reading /big/zyq/out/test_freec/wugang_chr.bam 486663374 lines read.. 0 reads used to compute copy number profile

Error: FREEC was not able to extract reads from /big/zyq/out/test_freec/wugang_chr.bam

Check your parameters: inputFormat and mateOrientation Use "matesOrientation=0" if you have single end reads

First, I got the ''GC_profile.cnp'' file through ''gccount -conf config.txt''. this is my config.txt:

[general]

chrFiles = /home/zyq/ref/ chrLenFile = /big/zyq/out/test_freec/panda_chr.len ploidy = 2 breakPointThreshold = 0.8 maxThreads = 16 window = 5000 outputDir = /big/zyq/out/test_freec sambamba = /home/zyq/miniconda3/envs/freec/bin/sambamba SambambaThreads = 16

intercept = 1

coefficientOfVariation = 0.062

degree = 3

GCcontentProfile = /big/zyq/out/test_freec/GC_profile.cnp

[sample]

mateFile = /big/zyq/out/test_freec/wugang_chr.bam inputFormat = BAM mateOrientation = 0

BTW,my bam file was sorted,and contains "chr" prefixes for chromosomes. @SQ SN:chrNC_048218.1 LN:212770937 @SQ SN:chrNC_048219.1 LN:199809881 @SQ SN:chrNC_048220.1 LN:147627920 @SQ SN:chrNC_048221.1 LN:144794249

my chrLenFile： 1 chr1 212770937 2 chr2 199809881 3 chr3 147627920

my chrFiles： chr1.fa chr2.fa chr3.fa....... and I used samtools to split it.

NC_048218.1 tccagctcaactcaggggaccggctgaaaaaggggtcccctactcctccgccatcttaac ctctcgaCCTccattaaacttttaattttaattctagcatagtcaacatatagtgttata

my GC_profile.cnp": 1 90000 0.4214 1 1 95000 0.5054 1 1 100000 0.5264 1 1 105000 0.4242 1 1 110000 0.527 1

thank you for your suggestions.

ZYongQi commented 11 months ago

Hi,this is ZY. I 've solved the problem before. When running freec,you must keep the name of each chromosome in chrFiles,chrLenFile and .BAM file consistent. I didn't use a .VCF file so my chromosomes in .BAM file start with "NC_.....". Then you must keep the same prefixes of each chromosome in chrFiles and chrLenFile to ensure freec to identify and extract reads from bam files. But still I have two questions to discuss:

  1. In your replies brfore ,if a .VCF file is used, a .BAM file with reads should contain "chr" prefixes for chromosomes. My purpose is to call CNVs in bam file .I wonder if it is necessary for me to use a .VCF file when calling CNVs. And if it is,what is the role of a .VCF file?

  2. As I mentioned before,I have many .BAM files to call CNVs. When I run freec with the parameter"coefficientOfVariation = 0.062",I found that the window sizes of each .BAM file are not the same , basicallly ranging from 800 to 1800. Under this circumstance, will I need to set a fixed window size value,such as 1000 or 2000, or just let freec to set windows automatically,though the windows of each .BAM file are not the same? Will this affect my subsequent analysis?

Good wishes to you and looking forward to your suggestions ,sincerely.