search

Oshlack / JAFFA

JAFFA is a multi-step pipeline that takes either raw RNA-Seq reads, or pre-assembled transcripts, then searches for gene fusions
https://github.com/Oshlack/JAFFA/wiki
Other
86 stars 21 forks source link

"No fusions were found for the following samples: BT474-demo MCF7-demo" #79

Closed ReWeda closed 4 months ago

ReWeda commented 2 years ago

Dear JAFFA Developers,

during the last couple of days I tried to solve an issue I'm experiencing running JAFFA (direct mode). Since I'm writing here, I've not been able to solve the problem by myself. I hope you can help me somehow.

I'm running JAFFA on a fairly decent machine (16 cores x 126 GB of ram) under Ubuntu 20.04 LTS. More information about the machine:

$gcc --version
gcc (Ubuntu 9.4.0-1ubuntu1~20.04.1) 9.4.0
Copyright (C) 2019 Free Software Foundation, Inc.
This is free software; see the source for copying conditions.  There is NO
warranty; not even for MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
$java -version
openjdk version "1.8.0_312"
OpenJDK Runtime Environment (build 1.8.0_312-8u312-b07-0ubuntu1~20.04-b07)
OpenJDK 64-Bit Server VM (build 25.312-b07, mixed mode)
$R --version
R version 3.6.3 (2020-02-29) -- "Holding the Windsock"
Copyright (C) 2020 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu (64-bit)

I refined the installation of JAFFA using the bash script you provided. Then, I generated a custom reference following the wiki (hg38 + gencodev39).

I tried running JAFFA direct mode on the demo data you provide with the following command:

./JAFFA-version-2.2/tools/bin/bpipe \
-n 16 \
-p jaffa_output=/path/to/JAFFA-Output/TEST \
/path/to/JAFFA-version-2.2/JAFFA_direct.groovy \
/path/to/Jaffa_DemoData/BT474-demo_*'.fastq.gz' \
/path/to/Jaffa_DemoData/MCF7-demo_*'.fastq.gz'

This command returns me the following error:

========================================= Pipeline Failed ==========================================

Command failed with exit status = 1 :

cd /path/to/JAFFA-Output/TEST ; /usr/bin/R --vanilla --args jaffa_results /path/to/JAFFA-Output/TESTBT474-demo/BT474-demo.summary /path/to/JAFFA-Output/TESTMCF7-demo/MCF7-demo.summary < /path/to/JAFFA-version-2.2/compile_results.R ; rm -f jaffa_results.fasta ; while read line; do /path/to/JAFFA-version-2.2/scripts/get_fusion_seqs.bash $line; done < jaffa_results.csv;             echo "Done writing jaffa_results.fasta" ;             echo "All Done." ;       echo "***********************************************************************" ;        echo " Citation: " ;            echo "   Davidson, N.M., Majewski, I.J. & Oshlack, A. ";             echo "   JAFFA: High sensitivity transcriptome-focused fusion gene detection." ;        echo "   Genome Med 7, 43 (2015)" ;          echo "***********************************************************************" ;

Use 'bpipe errors' to see output from failed commands.

Further inspecting the error via bpipe I get:

============================= Found 1 failed commands from run 471862 ==============================                                                                          
=========================================== Command 137 ============================================

Command    : cd /path/to/JAFFA-Output/TEST ; /usr/bin/R --vanilla --args jaffa_results /path/to/JAFFA-Output/TESTBT474-demo/BT474-demo.summary /path/to/JAFFA-Output/TESTMCF7-demo/MCF7-demo.summary < /path/to/JAFFA-version-2.2/compile_results.R ; rm -f jaffa_results.fasta ; while read line; do /path/to/JAFFA-version-2.2/scripts/get_fusion_seqs.bash $line; done < jaffa_results.csv;             echo "Done writing jaffa_results.fasta" ;             echo "All Done." ;          echo "***********************************************************************" ;        echo " Citation: " ;        echo "   Davidson, N.M., Majewski, I.J. & Oshlack, A. ";         echo "   JAFFA: High sensitivity transcriptome-focused fusion gene detection." ;        echo "   Genome Med 7, 43 (2015)" ;          echo "***********************************************************************" ;
Exit Code  : 1
Output     : 

        R version 3.6.3 (2020-02-29) -- "Holding the Windsock"
        Copyright (C) 2020 The R Foundation for Statistical Computing
        Platform: x86_64-pc-linux-gnu (64-bit)
        R is free software and comes with ABSOLUTELY NO WARRANTY.
        You are welcome to redistribute it under certain conditions.
        Type 'license()' or 'licence()' for distribution details.
          Natural language support but running in an English locale
        R is a collaborative project with many contributors.
        Type 'contributors()' for more information and
        'citation()' on how to cite R or R packages in publications.
        Type 'demo()' for some demos, 'help()' for on-line help, or
        'help.start()' for an HTML browser interface to help.
        Type 'q()' to quit R.
        > options(echo=F)
        Compiling the results from:
        TESTBT474-demo TESTMCF7-demo
        [1] "No fusions were found for the following samples:"
        [1] "TESTBT474-demo" "TESTMCF7-demo" 
        Error in file(file, "rt") : invalid 'description' argument
        Calls: read.delim -> read.table -> file
        Execution halted

The output directories for the demo data contains what follows:

$ls -lht /path/to/JAFFA-Output/TEST*
JAFFA-Output/TEST:
total 4,0K
-rw-rw-r-- 1 pipeline-84 pipeline-84 42 mag 17 16:06 checks

JAFFA-Output/TESTMCF7-demo:
total 23M
-rw-rw-r-- 1 pipeline-84 pipeline-84    0 mag 17 16:08 MCF7-demo.summary
-rw-rw-r-- 1 pipeline-84 pipeline-84  825 mag 17 16:08 MCF7-demo.reads
-rw-rw-r-- 1 pipeline-84 pipeline-84   78 mag 17 16:08 log_genome_blat
-rw-rw-r-- 1 pipeline-84 pipeline-84 2,3K mag 17 16:08 MCF7-demo_genome.psl
-rw-rw-r-- 1 pipeline-84 pipeline-84 1,4K mag 17 16:08 MCF7-demo.fusions.fa
-rw-rw-r-- 1 pipeline-84 pipeline-84 4,1K mag 17 16:08 MCF7-demo.txt
-rw-rw-r-- 1 pipeline-84 pipeline-84 405K mag 17 16:07 MCF7-demo.paf
-rw-rw-r-- 1 pipeline-84 pipeline-84  66K mag 17 16:07 MCF7-demo.fasta
-rw-rw-r-- 1 pipeline-84 pipeline-84 2,1M mag 17 16:07 MCF7-demo_discordant_pairs.bam.bai
-rw-rw-r-- 1 pipeline-84 pipeline-84 9,0M mag 17 16:07 MCF7-demo_discordant_pairs.bam
-rw-rw-r-- 1 pipeline-84 pipeline-84 5,5M mag 17 16:07 MCF7-demo_filtered_reads.fastq.1.gz
-rw-rw-r-- 1 pipeline-84 pipeline-84 5,6M mag 17 16:07 MCF7-demo_filtered_reads.fastq.2.gz
-rw-rw-r-- 1 pipeline-84 pipeline-84  90K mag 17 16:07 MCF7-demo_leftover_reads.fastq.1.gz
-rw-rw-r-- 1 pipeline-84 pipeline-84  94K mag 17 16:07 MCF7-demo_leftover_reads.fastq.2.gz

JAFFA-Output/TESTBT474-demo:
total 23M
-rw-rw-r-- 1 pipeline-84 pipeline-84    0 mag 17 16:08 BT474-demo.summary
-rw-rw-r-- 1 pipeline-84 pipeline-84 2,7K mag 17 16:08 BT474-demo.reads
-rw-rw-r-- 1 pipeline-84 pipeline-84   78 mag 17 16:08 log_genome_blat
-rw-rw-r-- 1 pipeline-84 pipeline-84 8,7K mag 17 16:08 BT474-demo_genome.psl
-rw-rw-r-- 1 pipeline-84 pipeline-84 5,0K mag 17 16:07 BT474-demo.fusions.fa
-rw-rw-r-- 1 pipeline-84 pipeline-84  16K mag 17 16:07 BT474-demo.txt
-rw-rw-r-- 1 pipeline-84 pipeline-84 570K mag 17 16:07 BT474-demo.paf
-rw-rw-r-- 1 pipeline-84 pipeline-84  42K mag 17 16:07 BT474-demo.fasta
-rw-rw-r-- 1 pipeline-84 pipeline-84 2,1M mag 17 16:07 BT474-demo_discordant_pairs.bam.bai
-rw-rw-r-- 1 pipeline-84 pipeline-84 8,9M mag 17 16:07 BT474-demo_discordant_pairs.bam
-rw-rw-r-- 1 pipeline-84 pipeline-84 5,6M mag 17 16:07 BT474-demo_filtered_reads.fastq.1.gz
-rw-rw-r-- 1 pipeline-84 pipeline-84 5,7M mag 17 16:07 BT474-demo_filtered_reads.fastq.2.gz
-rw-rw-r-- 1 pipeline-84 pipeline-84  64K mag 17 16:07 BT474-demo_leftover_reads.fastq.1.gz
-rw-rw-r-- 1 pipeline-84 pipeline-84  65K mag 17 16:07 BT474-demo_leftover_reads.fastq.2.gz

As far as I understood, It seems to me that JAFFA fails in calling fusion events for some unknown reasons. Then, the empty/incomplete file that is passed to the R script cause the error (just because it is empty? I don't think so...). I attach to this post the complete standard output of the failed run: JAFFA-direct-stdout.txt

Can you please help me making JAFFA run properly? Thanks in advance

Davide

nadiadavidson commented 2 years ago

Hi Davide, Thanks for providing so much detail about the problem. I wonder if the custom reference is incompatible with JAFFA for some reason. Can you post the result of ls -lh in /JAFFA-version-2.2/ and do "head" on the reference files you created? Does the pipeline run if you use the reference files provided rather than custom ones? Cheers, Nadia.

ReWeda commented 2 years ago

Hi Nadia,

here the content of the JAFFA directory:

$ls -lht ./JAFFA-version-2.2
total 576K
-rwxrwxr-x  1 pipeline-84 pipeline-84  21K mag 17 16:07 JAFFA_stages.groovy
-rw-rw-r--  1 pipeline-84 pipeline-84 2,0K mag 17 14:29 tools.groovy
drwxrwxr-x 13 pipeline-84 pipeline-84 4,0K mag 17 14:05 tools
drwxrwxr-x  2 pipeline-84 pipeline-84 4,0K mar 28 18:39 src
-rwxrwxr-x  1 pipeline-84 pipeline-84  21K feb 11 12:13 JAFFA_stages.groovy.backup
-rwxrwxr-x  1 pipeline-84 pipeline-84 2,3K set 11  2021 assemble.sh
-rwxrwxr-x  1 pipeline-84 pipeline-84 2,5K set 11  2021 compile_results.R
-rw-rw-r--  1 pipeline-84 pipeline-84  35K set 11  2021 COPYING
drwxrwxr-x  2 pipeline-84 pipeline-84 4,0K set 11  2021 cwl
drwxrwxr-x  2 pipeline-84 pipeline-84 4,0K set 11  2021 docker
-rwxrwxr-x  1 pipeline-84 pipeline-84 1,6K set 11  2021 get_spanning_reads.R
-rwxrwxr-x  1 pipeline-84 pipeline-84 6,4K set 11  2021 install_linux64.sh
-rwxrwxr-x  1 pipeline-84 pipeline-84 1,2K set 11  2021 JAFFA_assembly.groovy
-rwxrwxr-x  1 pipeline-84 pipeline-84 1,5K set 11  2021 JAFFA_direct.groovy
-rwxrwxr-x  1 pipeline-84 pipeline-84 1,7K set 11  2021 JAFFA_hybrid.groovy
-rwxrwxr-x  1 pipeline-84 pipeline-84 3,0K set 11  2021 JAFFAL.groovy
-rw-rw-r--  1 pipeline-84 pipeline-84 400K set 11  2021 known_fusions.txt
-rw-rw-r--  1 pipeline-84 pipeline-84  818 set 11  2021 LICENSE
-rwxrwxr-x  1 pipeline-84 pipeline-84  18K set 11  2021 make_final_table.R
-rwxrwxr-x  1 pipeline-84 pipeline-84  618 set 11  2021 README
-rw-rw-r--  1 pipeline-84 pipeline-84  713 set 11  2021 README.md
drwxrwxr-x  2 pipeline-84 pipeline-84 4,0K set 11  2021 scripts

I created a backup of the original JAFFA_stages.groovy since I had to edit the fastaInputFormat parameter for some test I did with my own fastq file. For the testing run on your demo data I used the JAFFA_stages.groovy you provide.

About the reference I generated (that is placed outside the JAFFA-version-2.2 directory) The content of the reference directory:

$ls -lht ./JAFFA_Reference/
total 12G
-rw-rw-r-- 1 pipeline-84 pipeline-84  45M feb 11 14:35 hg38_genCode39_blast.nhr
-rw-rw-r-- 1 pipeline-84 pipeline-84 3,1M feb 11 14:35 hg38_genCode39_blast.nin
-rw-rw-r-- 1 pipeline-84 pipeline-84 106M feb 11 14:35 hg38_genCode39_blast.nsq
-rwxr-xr-x 1 pipeline-84 pipeline-84 3,0G feb 11 12:26 hg38.fa
-rw-rw-r-- 1 pipeline-84 pipeline-84 892M feb 11 12:03 Masked_hg38.rev.1.bt2
-rw-rw-r-- 1 pipeline-84 pipeline-84 664M feb 11 12:03 Masked_hg38.rev.2.bt2
-rw-rw-r-- 1 pipeline-84 pipeline-84 892M feb 11 11:52 Masked_hg38.1.bt2
-rw-rw-r-- 1 pipeline-84 pipeline-84 664M feb 11 11:52 Masked_hg38.2.bt2
-rw-rw-r-- 1 pipeline-84 pipeline-84 2,9M feb 11 11:41 Masked_hg38.3.bt2
-rw-rw-r-- 1 pipeline-84 pipeline-84 664M feb 11 11:41 Masked_hg38.4.bt2
-rw-rw-r-- 1 pipeline-84 pipeline-84 177M feb 11 11:41 hg38_genCode39.rev.1.bt2
-rw-rw-r-- 1 pipeline-84 pipeline-84 106M feb 11 11:41 hg38_genCode39.rev.2.bt2
-rw-rw-r-- 1 pipeline-84 pipeline-84 177M feb 11 11:38 hg38_genCode39.1.bt2
-rw-rw-r-- 1 pipeline-84 pipeline-84 106M feb 11 11:38 hg38_genCode39.2.bt2
-rw-rw-r-- 1 pipeline-84 pipeline-84 400K feb 11 11:36 known_fusions.txt
-rw-rw-r-- 1 pipeline-84 pipeline-84 2,3M feb 11 11:35 hg38_genCode39.3.bt2
-rw-rw-r-- 1 pipeline-84 pipeline-84 106M feb 11 11:35 hg38_genCode39.4.bt2
-rw-rw-r-- 1 pipeline-84 pipeline-84 450M feb 11 11:33 hg38_genCode39.fa
-rw-rw-r-- 1 pipeline-84 pipeline-84 3,0G feb 11 11:31 Masked_hg38.fa
-rw-rw-r-- 1 pipeline-84 pipeline-84 457M feb 10 17:56 hg38_genCode39.fasta
-rw-rw-r-- 1 pipeline-84 pipeline-84 118M feb 10 17:51 hg38_genCode39.bed
-rw-rw-r-- 1 pipeline-84 pipeline-84  71M feb 10 17:50 hg38_genCode39.tab

The first 3 lines of the non-binary files:

$head -n 3 hg38.fa
>chr5
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

$head -n 3 hg38_genCode39.bed
chr1    11868   12227   ENST00000456328.2_exon_0_0_chr1_11869_f 0   +
chr1    12612   12721   ENST00000456328.2_exon_1_0_chr1_12613_f 0   +
chr1    13220   14409   ENST00000456328.2_exon_2_0_chr1_13221_f 0   +

$head -n 3 hg38_genCode39.fa
>hg38_knownGene_ENST00000456328.2__range=chr1:11869-14409__5'pad=0__3'pad=0__strand=+__repeatMasking=none
GTTAACTTGCCGTCAGCCTTTTCTTTGACCTCTTCTTTCTGT [....]
>hg38_knownGene_ENST00000450305.2__range=chr1:12010-13670__5'pad=0__3'pad=0__strand=+__repeatMasking=none

$head -n 3 hg38_genCode39.fasta
>hg38_knownGene_ENST00000456328.2 range=chr1:11869-14409 5'pad=0 3'pad=0 strand=+ repeatMasking=none
GTTAACTTGCCGTCAGCCTTTTCTTTGACCTCTTCTTTCTGTTCATGTGT
ATTTGCTGTCTCTTAGCCCAGACTTCCCGTGTCCTTTCCACCGGGCCTTT

$head -n 3 hg38_genCode39.tab
#chrom  chromStart  chromEnd    name    score   strand  thickStart  thickEnd    reserved    blockCount  blockSizes  chromStarts name2   cdsStartStat    cdsEndStat  exonFrames  type    geneName    geneName2   geneType    transcriptClass source  transcriptType  tag level   tier
chr1    11868   14409   ENST00000456328.2   0   +   11868   11868   16724991    3   359,109,1189,   0,744,1352, uc286dmu.1none  none    -1,-1,-1,   none    DDX11L1 none    none    pseudo  havana_homo_sapiens processed_transcript    basic   2   canonical,basic,all
chr1    12009   13670   ENST00000450305.2   0   +   12009   12009   16724991    6   48,49,85,78,154,218,    0,169,603,965,1211,1443,    uc286dmv.1  none    none    -1,-1,-1,-1,-1,-1,  none    DDX11L1 none    none    pseudo  havana_homo_sapiens transcribed_unprocessed_pseudogene  Ensembl_canonical,basic 2   basic,all

$head -n 3 known_fusions.txt
A1BG    ITIH4
A2M ALK
A2M ARFGEF2

$head -n 3 Masked_hg38.fa
>chr5
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Before generating my own reference I tested JAFFA with the one you provided and I experienced the same error. I tried generating my own as a possible solution. As a double check, I'm re downloading your reference to test JAFFA once again.

By the way, thank you for the support!

cheers Davide

nadiadavidson commented 2 years ago

Thanks for the extra information. If it's not a lot of trouble, can you try installing and running JAFFA version 2.1 to see if there is an issue with the current version. I will try installing on ubuntu to see if I get the same error and will get back to you.

Cheers, Nadia.

ReWeda commented 2 years ago

Hi Nadia,

some news here.

I re-downloaded the JAFFA package (let's call it "fresh install") and tried it on demo-data with the reference you provided. This time it worked correctly. I got an error (reported below) during the last step but JAFFA still generates the final output file so it's fine for me.

grep: TESTMCF7-demo/TESTMCF7-demo.fusions.fa: No such file or directory
cut: invalid decreasing range
Try 'cut --help' for more information.

It looks like an error related to file referencing that should be resolved selecting an output directory from the working dir of JAFFA (I'm guessing...)

Then I tried to recreate my own reference (hg38 + gencodev39) following the wiki. I noticed that the previous hg38_genCode39.tab file I was using was different than the file in the reference you provide. I corrected this issue, the I correctly ordered the genome reference file by chromosome and finally I created all the required reference files.

Running JAFFA with this reference, it fails again with the following error:

============================== Stage filter_transcripts (BT474-demo) ===============================
Done reading in transcript IDs
Reading the input alignment file, /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-Output/TEST39MCF7-demo/MCF7-demo.paf
0
terminate called after throwing an instance of 'std::out_of_range'
  what():  map::at
bash: line 1: 512161 Aborted                 (core dumped) /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-version-2.2/tools/bin/process_transcriptome_align_table /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-Output/TEST39MCF7-demo/MCF7-demo.paf 1000 /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA_Reference/Retry/hg38_genCode39.tab > /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-Output/TEST39MCF7-demo/MCF7-demo.txt
Done reading in transcript IDs
Reading the input alignment file, /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-Output/TEST39BT474-demo/BT474-demo.paf
0
terminate called after throwing an instance of 'std::out_of_range'
  what():  map::at
bash: line 1: 512177 Aborted                 (core dumped) /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-version-2.2/tools/bin/process_transcriptome_align_table /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-Output/TEST39BT474-demo/BT474-demo.paf 1000 /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA_Reference/Retry/hg38_genCode39.tab > /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-Output/TEST39BT474-demo/BT474-demo.txt
ERROR: Command failed with exit status = 134 :

/home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-version-2.2/tools/bin/process_transcriptome_align_table /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-Output/TEST39MCF7-demo/MCF7-demo.paf 1000 /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA_Reference/Retry/hg38_genCode39.tab > /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-Output/TEST39MCF7-demo/MCF7-demo.txt

ERROR: Command failed with exit status = 134 :

/home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-version-2.2/tools/bin/process_transcriptome_align_table /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-Output/TEST39BT474-demo/BT474-demo.paf 1000 /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA_Reference/Retry/hg38_genCode39.tab > /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-Output/TEST39BT474-demo/BT474-demo.txt

========================================= Pipeline Failed ==========================================

One or more parallel stages aborted. The following messages were reported:

Branch BT474-demo in stage Unknown reported message:

Command failed with exit status = 134 :

/home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-version-2.2/tools/bin/process_transcriptome_align_table /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-Output/TEST39BT474-demo/BT474-demo.paf 1000 /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA_Reference/Retry/hg38_genCode39.tab > /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-Output/TEST39BT474-demo/BT474-demo.txt

Branch MCF7-demo in stage Unknown reported message:

Command failed with exit status = 134 :

/home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-version-2.2/tools/bin/process_transcriptome_align_table /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-Output/TEST39MCF7-demo/MCF7-demo.paf 1000 /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA_Reference/Retry/hg38_genCode39.tab > /home/pipeline-84/Documents/Davide/FusionCallingToolsComparison/JAFFA-Output/TEST39MCF7-demo/MCF7-demo.txt

Use 'bpipe errors' to see output from failed commands.

I'll give a try to JAFFA 2.1 as suggested. I'll let you know how it performs asap.

Thanks for the support! Davide

ReWeda commented 2 years ago

I just finished testing JAFFA v2.1. Unfortunately, it behaves like version 2.2. It works with your reference but not with the one generated following the wiki.

nadiadavidson commented 2 years ago

Hi Davide, Sorry for the slow reply. There is a bug in JAFFA related to specifying an output directory name (e.g. -p jaffa_output), also see https://github.com/Oshlack/JAFFA/issues/72

So if you don't change the output directory and use the original reference files are you able to get the demo to run to completion? So the issue is compatibility with the custom reference? To help me solve this would you be able to send me the result of "head" on the reference files and "ls -l" in JAFFA-Output/TEST39BT474-demo and JAFFA-Output/TEST39MCF7-demo.

Cheers, Nadia.

ReWeda commented 2 years ago

Hi Nadia,

I'm sorry, I totally missed the email from github about your answer. As you stated, the problem with JAFFA seems to be exclusively related to the reference used. Avoiding the "-p" option and a custom reference, JAFFA works flawlessy.

Head of the Reference files are reported HERE

Content of the Demo output directory is:

ls -lht TEST39MCF7-demo

total 17M
-rw-rw-r-- 1 pipeline-84 pipeline-84    0 mag 20 14:59 MCF7-demo.txt
-rw-rw-r-- 1 pipeline-84 pipeline-84 243K mag 20 14:59 MCF7-demo.paf
-rw-rw-r-- 1 pipeline-84 pipeline-84  72K mag 20 14:59 MCF7-demo.fasta
-rw-rw-r-- 1 pipeline-84 pipeline-84 837K mag 20 14:59 MCF7-demo_discordant_pairs.bam.bai
-rw-rw-r-- 1 pipeline-84 pipeline-84 3,9M mag 20 14:59 MCF7-demo_discordant_pairs.bam
-rw-rw-r-- 1 pipeline-84 pipeline-84 5,4M mag 20 14:59 MCF7-demo_filtered_reads.fastq.1.gz
-rw-rw-r-- 1 pipeline-84 pipeline-84 5,5M mag 20 14:59 MCF7-demo_filtered_reads.fastq.2.gz
-rw-rw-r-- 1 pipeline-84 pipeline-84  94K mag 20 14:59 MCF7-demo_leftover_reads.fastq.1.gz
-rw-rw-r-- 1 pipeline-84 pipeline-84  98K mag 20 14:59 MCF7-demo_leftover_reads.fastq.2.gz