search

PacificBiosciences / HiPhase

Small variant, structural variant, and short tandem repeat phasing tool for PacBio HiFi reads
Other
71 stars 4 forks source link

reference letter case issue #19

Closed splaisan closed 1 year ago

splaisan commented 1 year ago

HI,

My VCF calls are from sniffles2 and somewhere in the pipeline the reference sequence letter case has been changed to lower-case, leading to the 'fatal' error below.

[2023-10-12T14:21:23.350Z ERROR hiphase]   Reference mismatch error: variant at chr1:10354 has REF allele = "ccctaaccctaaccctaaccctaaccctaaccctaacccctaacccctaaccctaaccctaaccctaaccct", but reference genome has "CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCCTAACCCTAACCCTAACCCTAACCCT".

Is there a hidden parameter that would allow ignoring case and running the tool?

Note: the pbsv calls from the same BAM are processed well so the issue has probably been introduced by sniffles2 when writing the VCF.

Thanks for your help

PS: I also post this on sniffles2 with cross ref to maximize my chance of finding a fix, no offence taken I hope

holtjma commented 1 year ago

Hey @splaisan,

The short answer is no, we don't have a way to ignore or correct allele casing in the VCF files. Also note that any lower case ALT alleles would probably lead to unexpected outcomes in the result, even if they do not lead to a full error. As a workaround, I suspect you could go through and convert everything to uppercase with a Python script or similar.

As a side note: we do not currently support sniffles2, partly because of deviations from expectations like this.

Matt

holtjma commented 1 year ago

Closing this for now since this is an unsupported caller.