When I annotate soybean SNP VCF file with annovar software, there is no result output. I hope you can give some suggestions. Thank you.
annovar version (20200607)
The command execution steps are as follows:
gffread zunla.gff -T -o Glycine_max.gtfgtfToGenePred -genePredExt Glycine_max.gtf soybean_refGene.txtsoybean_refGene.txt transcript:KRH74114 1 - 27354 28320 27655 28218 3 27354,27925,28138, 27824,27991,28320, 0 gene:GLYMA_01G000100 incmpl incmpl 2,2,0, transcript:KRH74115 1 - 58974 67527 62005 64061 5 58974,62566,63065,63333,64054, 62045,62644,63141,63417,67527, 0 gene:GLYMA_01G000200 incmpl incmpl 2,2,1,1,0,
transcript:KRH74114 Comment: this sequence (leftmost exon at 1:27354) is generated by ANNOVAR on Mon Jan 25 13:17:59 2021, based on regions specified in G
CATGTTCTACCAATGCTACCTTTTCTTTCCTAAGGAAAAAATCAATATACTTGCAGCGTCAAACATTTGCATGTGAAGACAAAGGCAGAACTTAAAGAAGCTATGTGTGTAGCACAACATGAGCAAATGGACTGTATGGTTGAGATTGAGAGTTCCA`
perl ../convert2annovar.pl -format vcf4old soybean.filter.vcf >GmVCF.avinputGmVCF.avinput 1 435 435 G A hom 6470.78 45712 20.13 25.78 1 947 947 A T hom 15367.9 11489 38.51 18.08 1 987 987 G A hom 18393.9 11235 44.85 17.50 1 1012 1012 A T hom 10648.7 12535 54.12 32.97 1 1028 1028 A T unknown 45339.6 12273 55.88 21.09 1 1105 1105 G A hom 52059.4 13477 58.04 16.90 1 1124 1124 A T unknown 225039 12558 57.80 42.90 1 1126 1126 G A hom 15470.6 13613 53.26 23.19 1 1131 1131 T A unknown 235252 12532 57.18 43.75 1 1137 1137 C T hom 8959.7 13617 50.72 39.64 1 1145 1145 G A unknown 228415 12514 58.09 42.12
Gm.exonic_variant_function and Gm.variant_function files were empty.
BB3.log ANNOVAR Version: $Date: 2020-06-07 23:56:37 -0400 (Sun, 7 Jun 2020) $ ANNOVAR Information: For questions, comments, documentation, bug reports and program update, please visit http://www.openbioinformatics.org/annovar/ ANNOVAR Command: ../annotate_variation.pl -out Gm -build soybean GmVCF.avinput ./ ANNOVAR Started: Mon Jan 25 21:42:04 2021 NOTICE: The --geneanno operation is set to ON by default NOTICE: Output files are written to Gm.variant_function, Gm.exonic_variant_function NOTICE: Reading gene annotation from ./soybean_refGene.txt ... Done with 89662 transcripts (including 1250 without coding sequence annotation) for 57147 unique genes NOTICE: Variants with invalid input format are written to Gm.invalid_input
Dear Dr.Wang,
When I annotate soybean SNP VCF file with annovar software, there is no result output. I hope you can give some suggestions. Thank you. annovar version (20200607) The command execution steps are as follows:
gffread zunla.gff -T -o Glycine_max.gtfgtfToGenePred -genePredExt Glycine_max.gtf soybean_refGene.txtsoybean_refGene.txt transcript:KRH74114 1 - 27354 28320 27655 28218 3 27354,27925,28138, 27824,27991,28320, 0 gene:GLYMA_01G000100 incmpl incmpl 2,2,0, transcript:KRH74115 1 - 58974 67527 62005 64061 5 58974,62566,63065,63333,64054, 62045,62644,63141,63417,67527, 0 gene:GLYMA_01G000200 incmpl incmpl 2,2,1,1,0,`perl ../retrieve_seq_from_fasta.pl --format refGene --seqfile Glycine_max.fasta soybean_refGene.txt --out soybean_refGeneMrna.fa soybean_refGeneMrna.fa
perl ../convert2annovar.pl -format vcf4old soybean.filter.vcf >GmVCF.avinputGmVCF.avinput 1 435 435 G A hom 6470.78 45712 20.13 25.78 1 947 947 A T hom 15367.9 11489 38.51 18.08 1 987 987 G A hom 18393.9 11235 44.85 17.50 1 1012 1012 A T hom 10648.7 12535 54.12 32.97 1 1028 1028 A T unknown 45339.6 12273 55.88 21.09 1 1105 1105 G A hom 52059.4 13477 58.04 16.90 1 1124 1124 A T unknown 225039 12558 57.80 42.90 1 1126 1126 G A hom 15470.6 13613 53.26 23.19 1 1131 1131 T A unknown 235252 12532 57.18 43.75 1 1137 1137 C T hom 8959.7 13617 50.72 39.64 1 1145 1145 G A unknown 228415 12514 58.09 42.12perl ../annotate_variation.pl -geneanno -dbtype refGene -out Gm -build soybean GmVCF.avinput ./Gm.exonic_variant_function and Gm.variant_function files were empty.
BB3.log ANNOVAR Version: $Date: 2020-06-07 23:56:37 -0400 (Sun, 7 Jun 2020) $ ANNOVAR Information: For questions, comments, documentation, bug reports and program update, please visit http://www.openbioinformatics.org/annovar/ ANNOVAR Command: ../annotate_variation.pl -out Gm -build soybean GmVCF.avinput ./ ANNOVAR Started: Mon Jan 25 21:42:04 2021 NOTICE: The --geneanno operation is set to ON by default NOTICE: Output files are written to Gm.variant_function, Gm.exonic_variant_function NOTICE: Reading gene annotation from ./soybean_refGene.txt ... Done with 89662 transcripts (including 1250 without coding sequence annotation) for 57147 unique genes NOTICE: Variants with invalid input format are written to Gm.invalid_input