Multiple primers per sample

[Fred-White94]

Hi, I have an ITS dataset with multiple forward and reverse primers per sample. Is it possible to add multiple (slightly different) primers to the config file and if so how should that be formatted?

[a-h-b]

Hi, can you specify how the primers are different? is it possible to summarize them as one set of degenerate primers? do they bind at the same positions? -AHB

[Fred-White94]

Hi, thanks for getting back so quickly. They are indeed a degenerate set with the last bases being identical to those in config.ITS1

[a-h-b]

you can give the degenerate sequence in the config file, then. Or am I missing something?

[Fred-White94]

Sorry - first time analysing ITS data (and not my dataset) The primers have identical adapters (of course) followed by 1-3 additional nucleotides followed by the identical primer sequence so perhaps not "degenerate"

ACACTGACGACATGGTTCTACA CTTGGTCATTTAGAGGAAGTAA; ACACTGACGACATGGTTCTACA T CTTGGTCATTTAGAGGAAGTAA; ACACTGACGACATGGTTCTACA AC CTTGGTCATTTAGAGGAAGTAA; ACACTGACGACATGGTTCTACA CTA CTTGGTCATTTAGAGGAAGTAA;

The question is how do I incorporate the extra potential letters between adapter and primer. Hope this is clear.

Thank you

[a-h-b]

you can just put the CTTGGTCATTTAGAGGAAGTAA in the config file. The primer step searches for this part and cuts it and the adapter off.

[Fred-White94]

Ok thanks for the quick solve!

[a-h-b]

you're welcome. Let me know if you run into any problems. -AHB

[thierryjanssens]

Hi all,

what about incorporating multiple primer set from a multiplex approach (i.e. different genes/regions)?

Activating conda environment: /home/minion/git/dadasnake/conda/cb1403239da0c2b661e2126fd0da49e1 [Tue Dec 14 16:08:35 2021] Error in rule primer_numbers: jobid: 16 output: reporting/primerNumbers_perLibrary.tsv, reporting/primerNumbers_perSample.tsv log: logs/countPrimerReads.log (check log file(s) for error message) conda-env: /home/minion/git/dadasnake/conda/cb1403239da0c2b661e2126fd0da49e1