search

amplab / snap

Scalable Nucleotide Alignment Program -- a fast and accurate read aligner for high-throughput sequencing data
https://www.microsoft.com/en-us/research/project/snap/
Apache License 2.0
287 stars 66 forks source link

Providing incorrect fasta file to index results in segmentation violation when searching #26

Closed bamueh closed 9 years ago

bamueh commented 10 years ago

Providing a fasta file without a header to snap index like so:

TAAAAAAATTTCTTAAAATAGCTTTAGAAACACCAGTCTGGATCTGTCCCATTAACTACTCCCTCCTAGCCAGCCTACTCCCAAAAGGATACCCCGGCCGGGTGAATGAAATTTTACACATACT

does not result in an error when calling

$ snap index file.fasta .

When using the resulting database, a segmentation violation occurs:

$ snap single . infile.fastq -o outfile.sam
Welcome to SNAP version 1.0beta.10.

Loading index from directory... 0s.  624 bases, seed size 20
MaxHits MaxDist %Used   %Unique %Multi  %!Found %Error  %Pairs  lvCalls NumReads    Reads/s
Segmentation fault: 11

If you need more information (e.g., the contents of infile.fastq), let me know.

bolosky commented 10 years ago

Thanks for the report. I’ll get a fix into a later version of SNAP (but I’m not going to expedite an update, since using a correct fasta file avoids the problem).

--Bill

From: bamueh [mailto:notifications@github.com] Sent: Tuesday, June 17, 2014 6:35 AM To: amplab/snap Subject: [snap] Providing incorrect fasta file to index results in segmentation violation when searching (#26)

Providing a fasta file without a header to snap index like so:

TAAAAAAATTTCTTAAAATAGCTTTAGAAACACCAGTCTGGATCTGTCCCATTAACTACTCCCTCCTAGCCAGCCTACTCCCAAAAGGATACCCCGGCCGGGTGAATGAAATTTTACACATACT

does not result in an error when calling

$ snap index file.fasta .

When using the resulting database, a segmentation violation occurs:

$ snap single . infile.fastq -o outfile.sam

Welcome to SNAP version 1.0beta.10.

Loading index from directory... 0s. 624 bases, seed size 20

MaxHits MaxDist %Used %Unique %Multi %!Found %Error %Pairs lvCalls NumReads Reads/s

Segmentation fault: 11

If you need more information (e.g., the contents of infile.fastq), let me know.

— Reply to this email directly or view it on GitHubhttps://github.com/amplab/snap/issues/26.

bolosky commented 9 years ago

Fixed in 1.0dev.68. If a FASTA file doesn't start with ">", snap will generate an error instead of building a broken index.