Closed DarioS closed 6 years ago
Hi Dario,
thanks for your feedback!
And again, you are completely right :) For some reason the controls included in the FASTA file are not set as default (which should be the case), so I will fix it with the next minor release 1.21.
The same applies for the removal of low read counts.
Best Jan
Using the version 1.20 beta Docker container to run the software, I clicked on GECKO V2 A+B button, but the number of extracted sequences matched to guides is low.
I think the cause of this problem is the default pattern
CACC(.{20})
. Note that it should instead beCACCG(.{20})
for GECKO V2 A+B, according to the specifications of the primer (i.e. TCTTGTGGAAAGGACGAAACACCG). Using the alternative pattern on the same sample, I find:Or maybe
CACCG?(.{20})
.I think that the dataset which I'm using is representative of such experiments, but reads of such screens are never made publicly available, so I can't be certain.
Also, the Set Controls panel in the Set Analysis Parameters tab remains empty, although the "Gene Identifier for non-targeting control(s)" input box should have a default list (i.e. NonTargetingControlGuideForHuman_0001_1, ..., NonTargetingControlGuideForHuman_1000_1).
Lastly, the low count filtering panel has a description box "... we recommend to remove sgRNAs with a read count of less than 20." but the default value in the input box is 0. Perhaps also make the input's default 20 for consistency with the recommendation?