search

cole-trapnell-lab / cicero-release

https://cole-trapnell-lab.github.io/cicero-release/
MIT License
56 stars 14 forks source link

# cell ordering can be done interactively by leaving out "root_cells" #60

Closed sylestiel closed 4 years ago

sylestiel commented 4 years ago

input_cds <- order_cells(input_cds, root_cells = "GAGATTCCAGTTGAATCACTCCATCGAGATAGAGGC")

What does this sequence equate to?

Thanks!

hpliner commented 4 years ago

Hello, that line refers to the name of a cell (i.e. column name of the expression matrix that refers to that cell). In the example data, the cells were named based on a barcode sequence. For more info on order_cells, see the monocle3 docs here!