Closed ctSkennerton closed 8 years ago
The read in question has this id:
HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792 2:N:0:AGGCAGAA
[crass_patternFinder]: Processed 200000 ...15 secProcessing interesting read: HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792
[crass_patternFinder]: Processed 126930690 ...8958 secProcessing interesting read: HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792
[crass_patternFinder]: Processed 253461380 ...17774 sec
[crass_clusterCore]: 82817 variants mapped to 7711 clusters
[crass_clusterCore]: creating non-redundant set
[crass_clusterCore]: 59178 non-redundant patterns.
[crass_singletonFinder]: Processed 200000 ...221 secProcessing interesting read: HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792
Processing interesting read: HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792
Processing interesting read: HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792
Processing interesting read: HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792
Processing interesting read: HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792
Processing interesting read: HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792
Processing interesting read: HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792
Processing interesting read: HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792
Processing interesting read: HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792
Processing interesting read: HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792
Processing interesting read: HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792
Processing interesting read: HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792
[crass_singletonFinder]: Processed 126930690 ...156940 secProcessing interesting read: HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792
Processing interesting read: HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792
Processing interesting read: HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792
Processing interesting read: HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792
SP: C DR: GCCCGCGCTGGGGCCGGTCTCCTGACC SP: GAGCCCCGCCCCGCCCGCCCCGGGGGGGGGGCCCTTCCCCCCGGCCGCCCCCGCCCCCGCCCCGGCCACACCGCCCCCCCCCCACCACGCTTCCTCCGCCCCCCCGCCCCGCGCCCGCCCCT Header: HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792
LowLexi: 168
1,27,
Sequence:CGCCCGCGCTGGGGCCGGTCTCCTGACCGAGCCCCGCCCCGCCCGCCCCGGGGGGGGGGCCCTTCCCCCCGGCCGCCCCCGCCCCCGCCCCGGCCACACCGCCCCCCCCCCACCACGCTTCCTCCGCCCCCCCGCCCCGCGCCCGCCCCT
Len: 150
---------------------------------------------
---------------------------------------------
HWI-ST1243:121:D1AF9ACXX:2:1101:1592:25792 64141
[crass_singletonFinder]: Processed 253461380 ...304748 sec
[crass_patternFinder]: Found 1085779 reads
[ERROR]: Something wrong with front offset! ss iter: 154
front offset: -32
ReadHolder.cpp : 412 : void ReadHolder::updateStartStops(int, std::string*, const options*)
[ERROR]: FATAL ERROR: parseSeqFiles failed
WorkHorse.cpp : 191 : int WorkHorse::doWork(Vecstr)
Seems to occur with the front offset returned by the DR aligner. This occurs when the front offset is a negative number, BUT negative numbers are valid and do not affect many other DR types that have a negative front offset
I just received a similar error. I'm using CRASS V 0.3.12
[crass_patternFinder]: Processed 20000000 ...262 sec [crass_clusterCore]: 58120 variants mapped to 32534 clusters [crass_clusterCore]: creating non-redundant set [crass_clusterCore]: 96300 non-redundant patterns. [crass_singletonFinder]: Processed 20000000 ...13428 sec [crass_patternFinder]: Found 433289 reads 185 : 219 [ERROR]: Something wrong with front offset! ss iter: 102 front offset: -34 Header: HWI-D00196:168:C66U5ANXX:3:2302:10815:3937 LowLexi: 1 34,76,102,100, Sequence:ATTCGGATCCGTATCAAATTTAAGTAGATAACAACAGTGTTGCGGATCCGGGATATTTTCTATCATGGATTCGGATCCGTATCAAATTTAAGTAGATAACA Len: 101
Hi Michelle,
crass doesn't crass for me when I use just this read which means that there is something funky happening with the full dataset that is causing this to occur or there is a difference in the settings that is causing this. Are you running it with any non-default settings? Is it possible to send me the dataset (or a subset of it that still causes a crash) so that I can debug it?
Hi Connor, thanks for your quick reply!
I ran CRASS with default settings. When I run crass on just that sequence I don't get an error either. Unfortunately today i cannot replicate the error (despite running 3 times yesterday with the same error). Must be an environment thing. I'll post back if i encounter this error again.
Best, Michelle
When processing M90809 dataset, obtained the following error message: