search

ctSkennerton / crass

The CRISPR assembler
http://ctskennerton.github.io/crass
GNU General Public License v3.0
35 stars 11 forks source link

fastq processing error #84

Open grokkaine opened 8 years ago

grokkaine commented 8 years ago

I have two batches of fastq files, the older one gets processed by Crass but the newer one throws this error.

[ERROR]: Header: HWI-D00456:77:C70WLANXX:1:1101:10963:2182 LowLexi: 112 0,21,62,84,104,126, Sequence:CACCATGGAAGACCTTCCTAACACCATGGTAGACATTCCTTACACCATGGTAGACCTTCCTAACACCATGGTAGACCTTCCTAACACCATGGTAGACCTTCCTAACACCATGGTAGACCTTTCTAA

Len: 126

ss list out of range; 126 > 125 ReadHolder.cpp : 924 : bool ReadHolder::getNextSpacer(std::string_) [ERROR]: ReadHolder.cpp : 235 : void ReadHolder::getAllSpacerStrings(std::vectorstd::basicstring&) [ERROR]: Fatal error in search algorithm! libcrispr.cpp : 146 : int searchFile(const char, const options&, ReadMap, StringCheck, lookupTable&, lookupTable&, time_t&) [ERROR]: FATAL ERROR: parseSeqFiles failed WorkHorse.cpp : 191 : int WorkHorse::doWork(Vecstr)

The fastq files check out right with fastQValidator. They were used for a metagenomic assembly before, so I don't expect them to be faulty (still you never know). I will try to cut out a complete FASTQ record and attach it to the issue.

What is this 125, my length here is 126?

ctSkennerton commented 8 years ago

I think I've fixed this bug. try downloading version 1.0.1 and see if it works.