labsquare / Poster

0 stars 0 forks source link

binary code to ACGT code ? #5

Closed dridk closed 7 years ago

dridk commented 7 years ago

What if you replace 0101 code from the center by ACGT code ? And by using color instead yellow ? Somthing close to :

image

it-s commented 7 years ago

can you give me some real code sequence? the longer the better. Something cool too. So at the fair you could talk about it too.

dridk commented 7 years ago

Oh... good idea... I can encode some secret message !

Le 18 juin 2017 17:51, "Eugene Trounev" notifications@github.com a écrit :

can you give me some real code sequence? the longer the better

— You are receiving this because you authored the thread. Reply to this email directly, view it on GitHub https://github.com/labsquare/Poster/issues/5#issuecomment-309285634, or mute the thread https://github.com/notifications/unsubscribe-auth/AB0pFyUROkJmL0NSH73MX-rKv2Ck68stks5sFUdmgaJpZM4N9chw .

dridk commented 7 years ago

http://earthsciweb.org/js/bio/dna-writer/

Is it enough? This is a piece of text from my favourite book.

TAGCGTCTAGACAGCCGTACTGTACTAAGCTCATGTACACTAAGCACTAGCATCTGTCTCGTCAGCATGACTGACAGCTAGCGTTGTTGACTAAGCCACCTAGAGATCCTGTCAACTTAGTGTCACTGAACGAGCCTCTGTATGAGCTAGCGTCTAGACAGCGTCTGTAGCCATGACAGCTAGCGTCTAAGCCTCACTACACTAAGCAGCTGTGCTAGCGTCCTACTCCTATGAAGCACTCTCTACAGCATGCTAAGCACTCACCTAAGCTAGCGTCTACTGCACAGCTGAGATCACGTACTGGTAACTATCAGCACAACTTCACGTCTGCTCCTATGAACGAGC

Le 18 juin 2017 17:53, "Sacha Schutz" sacha@labsquare.org a écrit :

Oh... good idea... I can encode some secret message !

Le 18 juin 2017 17:51, "Eugene Trounev" notifications@github.com a écrit :

can you give me some real code sequence? the longer the better

— You are receiving this because you authored the thread. Reply to this email directly, view it on GitHub https://github.com/labsquare/Poster/issues/5#issuecomment-309285634, or mute the thread https://github.com/notifications/unsubscribe-auth/AB0pFyUROkJmL0NSH73MX-rKv2Ck68stks5sFUdmgaJpZM4N9chw .

it-s commented 7 years ago

Relaced