search

milaboratory / mixcr

MiXCR is an ultimate software platform for analysis of Next-Generation Sequencing (NGS) data for immune profiling.
https://mixcr.com
Other
326 stars 79 forks source link

How to perform MiXCR on my spatial TCR data #1684

Closed yuyuleung closed 3 months ago

yuyuleung commented 4 months ago

Discussed in https://github.com/milaboratory/mixcr/discussions/1683

Originally posted by **yuyuleung** June 5, 2024 Hello, I wanna perform MiXCR analysis on my spatial TCR data, where multiple barcodes are assigned to a spatial spot (looked as a single cell). My .fq files are in the following format: read1.fq: 20bp (barcode) read2.fq: 90bp (mRNA) Besides, I have also generated a barcodeTranslate file, where which barcodes can be assigned to which cells are clarified. Like: spot1 CAACAAACAAAAATACTATATTAAC spot1 CAACAAACATAAATACAATATTAAC spot2 TACAACTGAAAATAATTATCATACC spot2 TACAACTGAATATAATTATCATACG ... How can I specify/define my multiple barcode sequences as a single cell to analyze? Thank you. Yuyu
mizraelson commented 3 months ago

I am gonna close this issue, the discussion is in #1683.