Demultiplex custom barcode

[Seongmin-Jang-1165]

Issue Report

Please describe the issue:

hello. i want to demultiplex direct RNA seq data(POD5 format).

i referenced the description "Custom Barcode Arrangements", but ther error is occured. i attach the error message. what is the problem of my code or something else..?

[arrangement] name = "custom_barcode" kit = ""

mask1_front = "" mask1_rear = "" mask2_front = "" mask2_rear = ""

Barcode sequences

barcode1_pattern = "BC_C%02i" barcode2_pattern = "BC_M3%02i" first_index = 1 last_index = 2 rear_only_barcodes = true

Scoring options

[scoring] max_barcode_penalty = 11 barcode_end_proximity = 75 min_barcode_penalty_dist = 3 min_separation_only_dist = 6 flank_left_pad = 5 flank_right_pad = 10 front_barcode_window = 175 rear_barcode_window = 175 midstrand_flank_score = 0.95

barcode_fastq

BC01 GTACTTTTCTCTTTGCGCGG BC02 GTGATTCTCGTCTTTCTGCG

[Seongmin-Jang-1165]

i used SQK-RNA004 library kit and barcoding with 2 specific-adapter

[malton-ont]

Hi @Seongmin-Jang-1165,

The parser is saying you have an error in the line name = "custom_barcode". There doesn't seem to be an error present in what you've pasted here, so please check the original file.

You also have some other issues:

• Your fasta file does not appear to be valid - identifier lines should begin with a >
• Your barcode1_pattern does not match the identifiers in your fasta
• You specify barcode1_pattern and barcode2_pattern, but also rear_only_barcodes - if you only have rear barcodes then there can be no barcode2_pattern
• A custom barcode arrangement must specify at least one of mask1_front or mask2_front - it looks like you're trying to sidestep this to perform adapter detection instead of barcodes? Dorado does not support this.

[Seongmin-Jang-1165]

hi @malton-ont

thank for your advice! it helps me a lot

i prepare library with target-specific adapter and put the barcode sequence into adapter. so it seems like detecting adapter...