search

pinellolab / CRISPResso2

Analysis of deep sequencing data for rapid and intuitive interpretation of genome editing experiments
Other
278 stars 95 forks source link

INDELs not recognized in the allele frequency table #406

Closed yifanzhou123 closed 7 months ago

yifanzhou123 commented 7 months ago

I ran CRISPRESSO2 using on a CRISPR/Cas9 edited loci, while the "Allele plots" shows several INDELs, the "Allele_frequency_table" does not reflect the same INDELs and recognize the INDELs as "TRUE" for "Unedited" column, and I noticed the "Reference_Sequence" has been altered with a "-".

Here is the command I typed in.

CRISPResso -r1 RH-9177_1_S1_L001_R1_001.fastq.gz -r2 RH-9177_1_S1_L001_R2_001.fastq.gz -a AACTAGAGGGCAGCCTTGTGGATGGCCCCGAAGCAAGCCTGATGGAACAGGATAGAACCAACCATGTTGAGGGCAACAGACTAAGTCCATTCCTGATACCATCACCTCCCATTTGCCAGACAGAACCTCTGGCTACAAAGCTCCAGAATGGAAGCCCAGTGCCTGAGAGAAGTCA -g TGTTGAGGGCAACAGACTAA --ignore_substitutions -o nowindow_175_not_trimmed

And attaching the Allele plots and Allele_frequency table: 9.Alleles_frequency_table_around_sgRNA_TGTTGAGGGCAACAGACTAA.pdf

Alleles_frequency_table_around_sgRNA_TGTTGAGGGCAACAGACTAA.txt

Was wondering if anyone can shed some light, thank you.

kclem commented 7 months ago

HI @yifanzhou123,

By default, CRISPResso creates a 'quantification window' of 1bp around your predicted cut site (based on your provided guide, -3bp from the end by default). You can read more about the quantification window parameters and default here.

In your plots, I can see an NGG PAM on the left side of your guide. It looks like you may have provided the guide in reverse orientation. Please provide the guide sequence with the PAM following on the right. In your case this would be -g TTAGTCTGTTGCCCTCAACA. Let me know if that fixes things!

Happy analyzing!

yifanzhou123 commented 7 months ago

Ah! Yes! Thank you! I have input the reverse complementary gRNA sequence, and it looks like it's working as expected now! Thank you for catching it!!