Open mruffalo opened 4 years ago
Under Python 3, the sequence (chromosome) names provided to MACS2 were retrieved as byte strings, then wrapped in str() before writing to disk. This resulted in sequence names like "b'chr1'", as in:
str()
b'chr14' 46787083 46787310 AAACATCGAAGGACACCATCAAGT b'chr3' 56262063 56262116 AAACATCGAAGGACACCATCAAGT b'chr2' 103894442 103894639 AAACATCGAAGGACACCATCAAGT
Tested this fix under Python 2 and 3.
Under Python 3, the sequence (chromosome) names provided to MACS2 were retrieved as byte strings, then wrapped in
str()before writing to disk. This resulted in sequence names like "b'chr1'", as in:Tested this fix under Python 2 and 3.