Closed seifudd closed 8 months ago
Hi Fayaz,
zUMIs does not support barcodes stored in headers and running already demultiplexed data. It is mandatory to have a BC field in the config file If you dont have access to the data prior to demultiplexing, I suggest to check here: https://github.com/sdparekh/zUMIs/wiki/Starting-from-demultiplexed-fastq-files
Thank you. This makes sense. Appreciate your response and help with this.
Hi, I need some help defining the inputs for processing plate-based RNA-Seq data (with UMIs) generated using the SMARTer® Stranded Total RNA-Seq Kit v3 - Pico Input Mammalian from Takara.
Description of sequencing protocol is here.
I have R1 and R2 per sample.
Here is the YAML file that I am using for running zUMIs for 1 sample - BMS073_retry4.zUMIs_config_formated.txt
Here is the barcode file - barcode_BMS073.txt
After running zUMIs, there are no Expression files generated.
The header of the fastq files (both R1 and R2) contains the barcode (included in the barcode file above), for e.g.
@lh00172:46:GW23091633rd:5:1101:3145:1064 2:N:0:ACTAAGAT+CCGCGGTT TTTGATCACCCGGGCACCTAGAGTGCGGAGTTGAGCACCTCAGAAGGGAGGTGTGGCCCTCAGGACATTGTCAGCATGTGCGATGATAGTGGAGGCCATGGATTTGAGAACATTTCAGAGAATATTTGATGGAGGGGAACGCCAAGGGGA + FFFFFFFFFFFFFFFFF-FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF5FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF5FFF5F-FFFFF-
What am I missing? Any help will be appreciated.
Thanks, Fayaz