--novel outputs the same gene if in multiple files

tseemann / mlst

:id: Scan contig files against PubMLST typing schemes

GNU General Public License v2.0

201 stars 47 forks source link

--novel outputs the same gene if in multiple files #85

Closed tseemann closed 5 years ago

tseemann commented 5 years ago

>spneumoniae.recP-47985f3c7d7e14458f345e3f4d1b2d6e orig.fa
CTGTAAAGGAATCCTTTGTCTCACCATCCAAGTTGATATCATTTGAATCATAAAGAACAACCAAC
>spneumoniae.recP-47985f3c7d7e14458f345e3f4d1b2d6e dupe.fa
CTGTAAAGGAATCCTTTGTCTCACCATCCAAGTTGATATCATTTGAATCATAAAGAACAACCAAC

CC: @cimendes