Open asherrar opened 1 year ago
This is probably the result of a typo in the file name. Can you try the same commend, except copy-and-pasting the file name from ls
?
Just re-ran it as you suggested - exact same error. Also confirmed the file name is correct, copied it from the error message and ran head
on it, got part of the VCF header as expected. Is it possible that vg autoindex
doesn't like VCFs with multiple alternate sequences per site? I swore I saw mentions of people using the 1KGP dataset with vg before, which is what I'm attempting to tinker with here.
No, I'm pretty sure that multiple alts shouldn't be an issue. This error is originating from htslib
, which makes me strongly suspect an issue with file validity or file I/O. I'll give it a try on my end to see if I can replicate it.
Alright, much appreciated! If you can think of anything else to test from my end, let me know. I'm currently splitting the multiple alts with bcftools
anyway for the sake of filtering, so as soon as that's done I'm going to test that in the same command to rule that out as the cause - will post an update when it's done.
In my hands, the command runs without any problems. I was able to reproduce the error output by adding a typo into the file name, but other than that I don't have any particular insight on this issue. Are all of the absolute file paths correct?
Yup, just double-checked both of 'em, copying directly from the command and sending 'em through head
:
$ head /home/asherrar/t2t_sequence/v2.0/chm13v2.0.fa
>chr1 CP068277.2 Homo sapiens isolate CHM13 chromosome 1
Caccctaaaccctaacccctaaccctaaccctaaccctaaccctaaccctaacccctaaaccctaaccctaaccctaacc
ctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccct
aaccctaaccctaacccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaacccta
accctaaccctaaccctaaccctaaccctaaccctaaccctaacccaaccctaaccctaaccctaaccctaaccctaacc
ctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccct
aaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaa
ccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaacc
ctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccct
aaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaa
$ head /scratch/asherrar/1kgp_vcf/1kgp.chrX.recalibrated.snp_indel.pass.chm13.v1.1.liftover.vcf
##fileformat=VCFv4.2
##ALT=<ID=NON_REF,Description="Represents any possible alternative allele not already represented at this location by REF and ALT">
##FILTER=<ID=LowQual,Description="Low quality">
##FILTER=<ID=PASS,Description="All filters passed">
##FILTER=<ID=VQSRTrancheINDEL99.00to100.00+,Description="Truth sensitivity tranche level for INDEL model at VQS Lod < -22120.414">
##FILTER=<ID=VQSRTrancheINDEL99.00to100.00,Description="Truth sensitivity tranche level for INDEL model at VQS Lod: -22120.414 <= x < -0.4496">
##FILTER=<ID=VQSRTrancheSNP99.80to100.00+,Description="Truth sensitivity tranche level for SNP model at VQS Lod < -39762.1377">
##FILTER=<ID=VQSRTrancheSNP99.80to100.00,Description="Truth sensitivity tranche level for SNP model at VQS Lod: -39762.1377 <= x < -65.1324">
##FORMAT=<ID=AD,Number=R,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth (reads with MQ=255 or with bad mates are filtered)">
The files exist and are where they're expected to be, as far as I can tell. The only thing I can think of is something about the environment itself is messing with things, or it being something that was fixed in v1.43.0 - is that what you used?
I tried again with 1.42.0 and had the same result. Could it be a file permissions issue?
I don't think so, gave the files full permissions (chmod 777
) to test and I get the exact same error. I'm chalking it up to an environment quirk at this point... will ask the folks who run the cluster to take a peek.
1. What were you trying to do?
I was attempting to use
vg autoindex
to create a graph using T2T-CHM13 as a reference and a VCF file built from 1KGP variants mapped to said reference.2. What did you want to happen?
To have a valid .vg file and associated indices for further processing.
3. What actually happened?
4. If you got a line like
Stack trace path: /somewhere/on/your/computer/stacktrace.txt
, please copy-paste the contents of that file here:5. What data and command can the vg dev team use to make the problem happen?
Reference: https://www.ncbi.nlm.nih.gov/assembly/GCA_009914755.4 VCF: https://s3-us-west-2.amazonaws.com/human-pangenomics/T2T/CHM13/assemblies/variants/1000_Genomes_Project/chm13v1.1/1kgp.chrX.recalibrated.snp_indel.pass.chm13.v1.1.liftover.vcf.gz (unzipped via
gunzip
)6. What does running
vg version
say?(installed via
singularity-hpc
and run as an Lmod module, if it helps at all - strangely I can't seem to grab v1.43.0 this way right now, may try removing completely and attempting to reinstall)