search

7PintsOfCherryGarcia / RiDiCulousFilter

Filter sequences based on a variety of conditions
MIT License
7 stars 0 forks source link

How to set -f for illumina PE reads #2

Open SC-Duan opened 4 years ago

SC-Duan commented 4 years ago

Hi, I want to extract the reads from a sample with illumina PE reads, should I cat R1.fq.gz and R2.fq.gz together? When I cat two files together and set "-C", I got an error "Segmentation fault (core dumped)". Same error happened when set "-C" with just R1.fq.gz. When I do not set '-C', the result contains all reads same as R1.fq.gz, can you give me some help? My command is "RiDiCulous kmer -c kmer.txt -f sample.filter.fq.gz >kmer.fq". And the content of kmer.txt file is "CAACTATTATCTAAAAATAATCAAGTTATTA". Thank you!

jkreinz commented 4 years ago

I'm also having a similar error:

./RiDiCulous kmer -c KMER_10per.list -f 27_10.R2.fastq.gz -k 25 gives me no error but outputs all reads in the input fastq, and adding the -C option throws the error malloc(): corrupted top size Aborted (core dumped)

ytguojian commented 3 years ago

Hi， Have you solved this error? How?

Dkyuan commented 2 years ago

Hi, I also want to know how to extract reads with kmer from pair end data. When I use the following command: RiDiCulous kmer -c tt -C -f ../clean_data/J159_1_clean.fq.gz -m 1 >test_J159.fq ## tt contains one target kmer sequence It gives me ne erro, but with all reads (no reeads filtered), And more， when I use less to check the result file (test_J159.fq), it dosn't show the read sequences correctly [the ID line is right, + line is right, quality line is right, but the sequence line is show sth like ^B^B^A]