-
Hello,
I'd like help understanding the logic of the dpal module in global mode.
It should find the best global alignment using the Needleman Wunsch algorithm correct?
However I see different behavi…
-
The current implementation of the analysis tool using Needleman-Wunsch algorithm is highlighting the contour between two chants. These mismatches and gaps are made of two notes, and in order to highli…
-
Hello,
this could be a silly question. According to the documentation, one can choose between three algorithms: Dekker, Needleman-Wunsch and MEDITE. I do not know how to specify that in the python …
ghost updated
4 years ago
-
1. Needleman-Wunsch Algorithm
2. Smith-Waterman Algorithm
These algorithms were originally developed for DNA sequencing but I read on SO, that they are at times used as string similarity metrics as …
-
Sorry to interrupt. Thabks for your sharing. I run your the alignment algorithm, but it shows the error that `alignment_result = needleman_wunsch(sys.argv[1], sys.argv[2], sys.argv[3], int(sys.argv[4…
-
-
There are other algorithms that are available in TextDistance that may be considered.
### Edit based
- MLIPNS http://www.sial.iias.spb.su/files/386-386-1-PB.pdf
- Strcmp95 http://cpansearch.perl.…
-
The read sequence is `ATGCCCAGGTGCTGAAGCCCC`. Bowtie 2 maps this to the guide RNA reference sequence `ATGAACAGGTTCCGCAGCGG` (all of the reference sequences in this analysis are 20 nucleotides long) an…
-
(As remarked by @LinguList in https://github.com/PhyloStar/CogDetect/pull/22#discussion_r115956831)
Currently, the `local` keyword in `distances.needleman_wunsch` comes from an afterthought/experim…
-
One of the main challenges our project faces is that we have multiple copies of the same text resource with degrees of cleanliness and annotations. For instance we will have 50 instances of the heart …