-
Adapter does not recognize this device yet. Would be nice to see this supported somehow
`
alexa2.0 | 2022-12-10 06:27:05.766 | warn | State "alexa2.0.Echo-Devices.amzn1.dgroup.fac25fd90392f0…
-
I think detecting minors could easily be done directly in drprg, no need to implement in Pandora. You get coverage info on the S and R alleles right? Just ask if the coverage on any R allele …
-
I haven't used the Pandora plugin in a week or so but after a restart of my machine I'm now receiving the error below in the logs from Mopidy-Pandora. The username and password are correct for Pandora…
-
- [x] integrate the module `importData` from the new package `DataTools`
- [x] remove old code (functions and tests)
- [x] remove not required dependencies
-
**Describe the bug**
Running `kitty +kitten themes` errors out with this error
```
~
▲ kitty +kitten themes
Traceback (most recent call last):
File "lib/python3.9/urllib/request.py", line …
-
# Download **ReSources** package in R
Run these codes in your local R console:
- `options(repos = c(getOption("repos"), PANDORA = "https://Pandora-IsoMemo.github.io/drat/"))`
- `install.packages(…
-
# TLDR Version:
We would like to know how we should do polkadot.js PR (or fork) to:
(A) Replace the polkaholic.io UI with polkadot.js apps UI, but augment it with Polkaholic APIs (more generally T…
-
RadioLib could be extended to support LoRaWAN networks (and it's been on the TODO/WIP list for quite a while now).
-
Right now the `ALT+RMB` places the cursor, but you can't drag it. In…
-
I have a weird situation where pandora is selecting ref genotype when it should clearly be the alt - the alt has the highest likelihood.
```
gid 330 . TGCCATTGGCGATAGCGCGGCCGGA …