-
Sequence: ATCCTTGTTTTGAGAAAAAAG
Identification: this ASV is so short that it has 100% matches to several things, of which the edible species are 1) Wolffia globosa, or duckweed, which is known as Pha…
-
```
What steps will reproduce the problem?
1.Attempt to install ASV Bible from the following link:
http://www.crosswire.org/sword/modules/ModDisp.jsp?modType=Bibles
2.Other textx installed without iss…
-
```
What steps will reproduce the problem?
1.Attempt to install ASV Bible from the following link:
http://www.crosswire.org/sword/modules/ModDisp.jsp?modType=Bibles
2.Other textx installed without iss…
-
- title: '16S data from: Diversity of Pico- to Mesoplankton along the 2000 km Salinity
Gradient of the Baltic Sea (Hu et al. 2016)'
- GBIF: https://www.gbif.org/dataset/9e29a2fe-d780-48a8-a93f-9ce…
-
Would be nice if `asv gh-pages` could grow a cmdline argument to specify a custom commit message to override the default "Generated from sources".
ev-br updated
5 months ago
-
We are using asv to benchmark a project whose `build-system.requires` field in `pyproject.toml` contains `"setuptools >= 30.3.0"`. When asv 0.6.2 prepares a virtualenv for this project, it installs v…
-
We have sequenced **nasopharyngeal (NP) specimens** from infants which are in general **low biomass specimens**. We included non-template controls in each run.
Overall, 128 NTCs and 708 biological sa…
-
1. Create a new searchable multivalue field named `dnaSequenceID ` in the ES index
2. When a DNA derived data extension has data in the field `DNA_sequence`, populate `dnaSequenceID ` as follows:
-…
-
-
If I create a new benchmark I generally want to run the benchmarks for all existing releases (in my case git tags). The `-b` optional already helps to select only the new test but it's either not easy…