-
Hey! Another quick question: How does indexing work for ProteinMPNN when there are missing residues present in the PDB file? It looks like it will add "X" to the output sequences where it identifies g…
-
Thanks for the good work,
is it possible to input AA seq with wildcard residues?
-
### **Describe the Problem**
Protein has a cysteine residue inserted.
### **Sequence Data**
>KOD DNA Polymerase (BBF10K_003252):
>ATGATCCTGGACACCGATTACATCACCGAGGATGGCAAACCGGTGATCCGTATCTTCAAAA…
-
Currently, Mod Fill simply colors a cell black if anywhere in the series there is a representative of the corresponding congruence class. You can watch the diagram fill in to get some sense of when in…
-
The order of the conformer site residues seems to be random:
```
residues: [A/66/SER, A/70/LYS, A/71/HIS, A/64/TYR, A/72/TYR, A/69/ARG, A/65/CYS,
A/67/SER, A/68/ARG]
```
Each time you r…
-
Cleared the quiz list but left side still displays question.
 to generate pharmacophore models for a protein simulated with probes and analyzed using DruGUI. I h…
-
Hello, how could I minimize only a single residue and keep the rest of the protein rigid, I also would like to keep the side chain torsions of this residue constrained, essentially the backbone should…
-
When I want to change the color for a small portion of the residue or just one of them, it will not change anything. However, when I increase the selection range, it will affect the structure. How can…