-
## Summary
Cannot run cargo run --release demo_closures.py
Rustc:
rustc 1.81.0 (eeb90cda1 2024-09-04)
binary: rustc
commit-hash: eeb90cda1969383f56a2637cbd3037bdf598841c
commit-date: 2024-…
-
**Describe the bug**
The logic of defining an initial pressure distribution is different from all other methods in that it can not be modified after being defined, throwing the error: `TypeError: 'N…
-
R-4.5-linux
https://github.com/r-universe/pharmaverse/actions/runs/10886780972/job/30207926288
```
* checking examples ... [17s/17s] ERROR
Running examples in ‘chevron-Ex.R’ failed
The error mo…
-
**Describe the bug**
Using `make_multi_bowl` results in an error as the wrong type of arguments are passed to `make_bowl`, resulting in the error
`BeartypeCallHintParamViolation: Function kwave.…
-
### Describe the bug
The setup conditions are with WooPayments 8.2.1 + [SiteOrigins Widgets bundle](https://wordpress.org/plugins/so-widgets-bundle/) + using the classic widget settings/layout. When …
-
**Describe the bug**
The value of alignment coverage is miscalculated.
**To Reproduce**
>lcl|NZ_CALUAQ010000001.1_prot_WP_278902228.1_145 [locus_tag=QDJ88_RS00725] [protein=hypothetical protei…
-
So my Reference fasta header is like
```
>kraken:taxid|520|NZ_CP018042.1 Bordetella pertussis strain J313 chromosome, complete genome
ATGGATTTTCCCCGCGAATTTGATGTGATCGTCGTTGGTGGCGGTCACGCCGGTACGGAG…
-
https://mega.nz/folder/ApB2nlyB decryption key
-
To reproduce:
[Download this binary data file](https://drive.google.com/file/d/1a_IEd8UcnatlNl_PYsNimupvTVkNiRhA/view?usp=sharing), then:
`vdccreate -numts 1 -dimension 192x192x120 -extents -13.…
-
Summary of request: Add a new organization to ROR
Name of organization: Mātai Medical Research Institute*en
Website: https://www.matai.org.nz
Domains: matai.org.nz
Link to publications: https://…