-
When I try to connect via openocd to a STM32F407IGH6, openocd reported `Error: Error connecting DP: cannot read IDR`
Here is the log from openocd
```
(base) ttwards@MiWiFi-RC06-srv [~/esp/wireless…
-
its only a test, but such recursion might lead to stackoverflow:
```
[java] java.io.IOException: Stream closed
[java] at java.base/java.io.BufferedInputStream.getBufIfOpen(BufferedInputS…
-
### What is kmod?
Quote from [kmod's README](https://github.com/kmod-project/kmod/blob/250330e6f5fd912c26efe916622ef61990ddb6fc/README.md):
```
kmod is a set of tools to handle common tasks with …
-
Subpackages currently compile and tests pass, but generate_reads section is a mess. I am going to focus my effort on getting that code functional and compatible with the new pieces.
-
fastplong -w 128 -Q -i ont.fq.gz -o fastplong.fq.gz
Trying to detect adapter sequence at read start
Detected: TGTACTTCGTTCAGTTACGTATTGCT
Trying to detect adapter sequence at read end
Found possib…
-
Stream `sane_read()` response instead of needing to call this method repetitively.
-
This input which i give the command line gives the app an error and causes…
-
### Resolving `libevdev` and Build Errors
This error indicates that you're missing some system dependencies required to build and compile the project, especially libraries and tools related to `lib…
-
I constantly get hit by this error when executing:
```
oha -c 150 -z 10s -m GET "http://127.0.0.1:4000/hello" --json --latency-correction --disable-keepalive > benchmark.json
```
```
8:00AM F…
-
### Extension Version
1.9.4
### Description
The latest version seems to require extra permission to read browsing history, can you please explain why this is required? and perhaps include the expla…