-
This would be useful for streaming signals. Could be implemented using #8
-
fastplong -w 128 -Q -i ont.fq.gz -o fastplong.fq.gz
Trying to detect adapter sequence at read start
Detected: TGTACTTCGTTCAGTTACGTATTGCT
Trying to detect adapter sequence at read end
Found possib…
-
## ✨ Feature
In #10271, we are adding functionality to use the "next" and "previous" candidates buttons (on the candidate application page) with all candidate tables. However, it will be limited to o…
-
Hi @FrusqueGaetan , thank you for the excellent work on the papers and for sharing this code!
I had two questions I hope you can help me with:
1. [Lines 221-234 ](https://github.com/FrusqueGaetan/…
-
Hi, everyone. Do you know if the visual-inertial odometry in the bebop package is using a Kalman filter or some filtering algorithm to estimate the drone Position?
-
-
On my Dell machine, the time to empty estimation is heavily changing with each refresh of i3status, depending on the load currently on the machine. This was not present on my previous 2015-ThinkPad. I…
-
> The following bug was [originally reported](https://sourceforge.net/p/chocolate-doom/bugs/75/) on Sourceforge by [fraggle](https://sourceforge.net/u/fraggle/profile/), 2010-08-08 17:39:44:
Attached…
-
---
Author Name: **Gabriel Lander** (@gclander)
Original Redmine Issue: 1902, https://emg.nysbc.org/redmine/issues/1902
Original Date: 2012-07-10
Original Assignee: Anchi Cheng
---
When trying to …
-
Hi there,
thanks for offering your code. I could get it working, but i wonder if it is possible to get a higher resolution mask.
I changed the code like this
```
targetWidth = imgWidth +1
targe…