-
![image](https://github.com/user-attachments/assets/1e6aac66-713a-42b8-a88f-f7cc2bbc5114)
```
+ source /opt/savant/adapters/shared/utils.sh
/opt/savant/adapters/gst/sources/media_files.sh: line 8…
-
Hello there! I see your README mentions Staedtler Triplus pens with an adapter, I don't suppose you're able to share a 3D printable adapter for a HP/Roland plotter for these pens? 🙏🏻
-
Storage adapters that are contributed by the community currently become part of the OpenFGA repository + binary, and maintaining them becomes responsibility of the core OpenFGA team.
In order to sup…
-
Adapters of type CLOUD and SCHEDULED should NOT set seconds in cron spec as this will disable autmatic distribution.
-
I have paired end fastq file which has 2 adapters
Forward primer: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Reverse primer: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
Please tell me which lines of Script.py nee…
-
Hello,
I'm using the following script to fine tune the llama3 model with a custom dataset of questions & responses using the `{'prompt: "", completion:""}` format defined [here](https://github.com/…
-
When some error occurs - it can be seen in server console.
But it would be convenient also to forward to client. At the moment just empty response is returned.
It can be also useful to provide e…
-
### Feature request
Is it possible to combine multiple LoRA adapters like you might do to combine multiple styles with Stable Diffusion?
### Motivation
I think we could get higher quality model out…
-
i have successfully fine-tuned the model using QLORA for a custom use case. now i have the LoRA adapters and can you tell how to use it for the inference. maybe merge lora weights with the original mo…
-
### Summary of the new feature / enhancement
`dsc` only has visibility in the top most layer. This means that functions that get called such as `parameter()` and `reference()` can only access those …