-
Hello,
Is it possible to root the gateway v3 like the vacuum robots? i've seen your talks and references to the NXP firmware, but it seems that the newer gateway actually run linux (on the i.mx6 So…
-
# Rooting Firmware Ori Bolt BL-100 | Radito's Blog
Apa itu Rooting ? Rooting pada perangkat atau sistem terbenam adalah proses untuk mendapatkan akses ke sistem operasi perangkat yang memungkinkan pe…
-
This is an awesome project, and I just want you to know that once you finish it, you won't be the only one using it. :)
Any ETA on a working beta?
-
A user recently sent me a tree and was astounded by what he is seeing in PATRIC, so I had to tell him that I always take the newick file and visualize the tree in FigTree due to this problem, but its …
-
as asked in the title,
Is this possible without rooting?
-
Sometimes the midpoint rooting fails, e.g. searching for sequence [ANTIC057-20](http://bins.boldsystems.org/index.php/Public_RecordView?processid=ANTIC057-20)
```
AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATT…
-
## Is your feature request related to a problem? Please describe
I just like to be able to check the software version from the python import, as opposed to querying conda or rooting around in an inst…
-
Some rooting skills like wingclip or mage related cc toggle the walk/run mode making pvp impossible, especially in a bg where it is very difficult to understand if you have been rooted again or forced…
-
When I try to root the Dreame W10 according to the instructions when I click on the reset button for any amount an error pops up showing that `/etc/os-release` is missing and no login prompt appears..…
-
Servo will do a lot more rooting and unrooting than Gecko, because we have a JS-managed DOM. This is especially the case once we stop using the conservative stack scanner.
SpiderMonkey stores roots …