-
### Issue Description
In the MWE below, I would expect summary_plot to return a bar plot per class (this was the old behavior). Instead, no matter the argument in `plot_type`, I always get the intera…
-
cqid: VisIt00008958cqsubmitter: Mark Millercqsubmitdate: 08/11/09 This is related to 8959. Our scatter plot does not generate actual paths in 'phase space' even if the input data is 'phase related'. A…
-
In one of our apps, we have a plot that sits on top of a custom viewport, and we use this plot to chart the velocity and acceleration of our custom viewport to debug scrolling momentum.
This plot s…
-
I illustrate the problem with the `dots` dataset:
```python
import pandas as pd
from plotnine import *
dots = pd.read_csv('https://raw.githubusercontent.com/mwaskom/seaborn-data/master/dots.cs…
-
When plotting a line chart using `marker=braille`, the rows are not aligned properly. In the terminal they are printed correctly, but not when saved to text or html file.
-
Hi,
It would be great if users can specify how ggbar and ggdot order the items in the plots. Currently, the default is ordering by the name of the items (pathways, etc) or Rich factor (% in genome…
-
```
Add box selection to scatter plot and dot view. The user interaction should be
as follows:
(a) user presses mouse button (mouse down) in view
(b) user moves mouse (button still down)
(c) all it…
-
Could you try this?
https://plot.ly/python/line-and-scatter/#set-size-and-color-with-column-names
you can give a dataframe and the columns that will appear in the hover. That will help trying to…
-
This is a minor issue because there are nice workarounds, but I thought it's better recorded here. As described in this email thread
https://www.pmel.noaa.gov/maillists/tmap/ferret_users/fu_2019/ms…
-
As the title says, I want to plot the RNA structure in a postscript.
I can plot it without colors using this snipped:
```
CDS = 'AUGGAUCAAUCUAAUCGUUACGCGAAUUUGAACUUAAAAGAAGAAGAUUU'
mfold = RNA.fol…