-
Overall met expectations
In this first project I look at two primary items with the main goal being to stop inefficient or bad practices early.
First did you use divs, ids/classes to manage and …
-
Overall met expectations.
In this first submission I look for two items.
Did you use divs, classes/ids to organize your content and apply styles.
Great on this.
Second is your css efficient …
-
On resources we have updated selection function. So when record is filtered only those which remains on filter will retain its selection all invisible records will be unselected. We need to perform sa…
-
Is there a way to sensibly skip over Ns? Ideally still annotate the surrounding sequence.
This is a sample sequence from a hard-masked hg38 ref.
```
echo TCCAAATGTCCACTTGGAGGCTCTACGAAAAGAATGTTTCA…
-
Overall met expectations
In this first project, I look at two primary items with the main goal being to stop inefficient or bad practices early.
First, did you use divs, ids/classes to manage an…
-
Hi.
Thank you for your hardworking, script is working well.
Just want to issue the new orders here, new big potion + new arena.
Rah90 updated
4 years ago
-
**Is your feature request related to a problem? Please describe.**
As a developer I want to share common, non-sensitive configuration to make the initial setup as easy as possible. In our case that m…
-
Overall met expectations
In this first project, I look at two primary items with the main goal being to stop inefficient or bad practices early.
First, did you use divs, ids/classes to manage an…
-
Overall exceeded expectations.
In this first project I look at two primary items with the main goal being to stop inefficient or bad practices early.
First did you use divs, ids/classes to manag…
-
Is there any outlook on automatic derivations of the traits in this crate?
I tried to write a derive crate, but got stuck. Deriving for example `AbsDiffEq` for structs could be done by calling `Abs…