-
Was able to get things nominally up and running based on the following:
> To install, clone it, cd cortex/ec3 (ec = explore-compress, the intellectual lineage of DreamCoder, which was ec2 in their…
-
Would be nice to have a way to add an arrow to the angle arc, like on the attached image.
![oriented_angles_between_vectors](https://user-images.githubusercontent.com/344328/88461329-6dc2f480-ce9a-11…
-
- **Draft Title:**
- **Length:** 10-20 min full presentation
- **Links:** Two relevant videos:
1. https://youtu.be/CZGDhgcQL6I
2. https://drive.google.com/file/d/1J1zPrdtY9IotvrqOTqPYsppRZYUxGe3H…
-
If the primer pair is oriented with the left primer on the positive strand and right primer negative, the amplicon span should have `Strand.POSITIVE`.
```
GGTCCAGTTCAAGTGCTGGGAGAGCATCCTCCACAAGGTCT…
-
Currently, string representation of LoadError contains only fields without human-friendly description
-
The [`OrientedBoundingBox::fromPoints`](https://github.com/CesiumGS/cesium/blob/864c4a6006e1ce34482544a7e1ce62a5773a2801/packages/engine/Source/Core/OrientedBoundingBox.js#L141) method implements an e…
-
# 모니터링은 마틴 파울러처럼: Domain-Oriented Observability 도입기
https://engineering.ab180.co/stories/monitoring-like-martin-fowler-domain-oriented-observability
-
-
### Describe the bug
CHATGPT4 has unconstrained vector definitions within 3d and 2d graphic generating.
[Half_Round_Solid_Spatial_Logic_Feedback.pdf](https://github.com/user-attachments/files/17695…
-