-
https://microsoft.github.io/debug-adapter-protocol/
That is, allow `priroda` to be used as a backend within vscode or similar. Obviously, this would be a lot of work, but it could have some incredi…
-
Dynamic SPARQL query construction is essential for how `rdfproxy` works and also the (conceptually) most difficult and potentially error-prone part of the library.
Basically, the SPARQL adapter has…
-
fastplong -w 128 -Q -i ont.fq.gz -o fastplong.fq.gz
Trying to detect adapter sequence at read start
Detected: TGTACTTCGTTCAGTTACGTATTGCT
Trying to detect adapter sequence at read end
Found possib…
-
The specification requires the debug adapter to send an `initialized` event back to the client *after* the `initialize` response has been returned:
 issue with the same topic (use the search!)
- [X] This issue is …
-
Positron currently ships with a Jupyter Adapter, which bridges the Jupyter protocol and Positron's own protocol for language runtime messages. This module requires us to have native bindings to ZeroMQ…
-
there is a section for Language Server Protocol: https://github.com/eclipse/lsp4j/blob/master/documentation/README.md#implement-your-language-server
it would be nice to have documentation for the D…
-
VS proper has some data visualization like this:
...and personally I've never been a fan of how we represent things like XML elements or binary data in debug hovers and the REPL. In large part …
-
### Description of the problem
> Replace this line with your answer.
### Description of your products
> - the product name of your NAS model
>>>DS423+ ( with an INTEL Celeron J4125.
> …
-
### Current Behavior
Defining two ingress definitions pointing to single service with pathType prefix and different paths will cause
```
error adapter/etcd.go:141 failed to create object, ig…