-
-
Which manufacturers' sequencing adapters are included in the reference database of FCS-adaptor? Does it include BGI's sequencing adapters (BGISEQ/MGISEQ)?
Forward filter: AAGTCGGAGGCCAAGCGGTCTTAGGAAG…
-
Hi again Paul,
I like the social usefulness of this project and the way it could transform lives. Given the state of current voice technology, voice assistance for the disabled feels like an area w…
-
Add a comment introducing yourself to the community. Please include
Name:
Affiliation:
Interest in Joining BDA:
-
# Goal
Set project milestone goal to make all examples [WCAG2.0AA compliant](https://www.w3.org/WAI/tutorials/forms/). Set project goal to support accessibility and inclusive design.
## Purpose
B…
-
**Describe the problem**
Whenever the text of the button for an expandable section introduces/summarizes the content it describes, the toggle is also functioning as a heading. In such cases, the user…
-
# Blogs for `Blogs/category/graphics_designing`
### Please make sure to add daily 1 Blog Post or Weekly 4 Blog Posts of the following topics
- [ ] "10 Essential Tips for Effective Graphic Design"
-…
-
As we talk to partners the discussion often takes the form of translating milestones into features and shipping timelines is often the body of the discussion (i.e., the typical question is "when will …
-
Your CMSIS-RTOS documentation states:
> The CMSIS-RTOS API is a generic RTOS interface for ARM® Cortex®-M processor-based devices. CMSIS-RTOS provides a standardized API for software components tha…
-
We can use github's open api for this.
Visit https://developer.github.com/v3/users for more info on how to get it.
GET request to https://api.github.com/users/{username} return public information
…