-
Currently we display only a brief summary on front page
> What's Byld?
> Byld is the software development club of IIIT-Delhi. We’re a bunch of students who love building apps and hacks using vario…
-
# Abstract
ipEHR is about putting patients first, but gives opportunities to all parties of the medical market to establish trustless, safe, event-based data exchange respecting data sovereignty. Pat…
-
## Project Strengths
- You showed creativity and strong problem-solving throughout the project in combining technologies and libraries you haven't used before. The end result is a project that shows o…
-
### Is this a feature request or a bug report?
* [x] Feature request
* [ ] Bug Report
### What is the current behavior?
Currently `redesert` is composed of several sub-libraries that all do sp…
ahoym updated
6 years ago
-
Which manufacturers' sequencing adapters are included in the reference database of FCS-adaptor? Does it include BGI's sequencing adapters (BGISEQ/MGISEQ)?
Forward filter: AAGTCGGAGGCCAAGCGGTCTTAGGAAG…
-
As this is default for RHEL and some hospitals.
Links to #6
-
vecna updated
2 years ago
-
When a cluster is set up to run an application, there's typically also some shared infrastructure such as databases or message brokers that allows transferring data between different application serve…
-
I have been using the Node ewelink-api for years and really do like the automation it gives me. I wrote about it here: https://kevinsaye.wordpress.com/2020/11/03/home-automation-creating-an-azure-fun…
-
Don't know if this is the right place to ask this or not, but I want to know how did you simulated TEE in this project ?
Thanks