-
Currently there's a bit of Nix complexity in the flake. It would be pretty crass to copy/paste this into nixpkgs.
So better extracted from the flake, suitable for direct consumption.
@jaredmont…
-
CRASS Finds CRISPR spacers and inserts
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3664793/
https://github.com/ctskennerton/Crass
-
stops working afther a long time off use
-
I am try to connect my local database odoo community version 10 on mobile app, after successful login it will crashed and not open. please check attached file.
sockets:searching for socket 0x3175a family 2.269)Error (criu/sk-inet.c:191): inet: Connected Tcp socket, con…
-
For some samples, Crass seems to hang (for days, until it gets killed) at the `crass_patternFinder` step. I tested it for `fastq` and `fasta` input of the same file. When inspecting the output it seem…
-
Hi,
I attempted running `crass` on my data. The the command below was issued followed by the STDOUT:
```
$ crass -o /scratch/users/snarayanasamy/LAO_TS_CRISPR/D20/crass_mg-reads /scratch/users/snara…
-
Hii
I am using pojav luncher for play minecraft, it's working on Android I have mobile hit colour crass on pojav 1.21 can you fix.
…
-
Document question about send stream size and reflinks.
- https://bugzilla.kernel.org/show_bug.cgi?id=216148
- https://www.reddit.com/r/btrfs/comments/wljt4s/btrfs_send_breaks_reflinks
- Answer ht…
kdave updated
3 months ago
-
Hi Connor,
I have a subset of some data in the file test.txt. Each sequence in this fasta file contains one of two DR's which differ by only a single bp GTTCCAATTAATCTTAAACCCTA**C**TAGGGATTGAAAC vs GT…