-
### What went wrong, step-by-step?
1. A pub has editors in addition to authors as part of a volume
2. Cite function includes editors (including Bibtex)
3. .In Crossref XML deposit, editors ap…
-
### **Describe the Problem**
Protein has a cysteine residue inserted.
### **Sequence Data**
>KOD DNA Polymerase (BBF10K_003252):
>ATGATCCTGGACACCGATTACATCACCGAGGATGGCAAACCGGTGATCCGTATCTTCAAAA…
-
The title kind of says it all: could we consider transferring this repository to https://github.com/OpenEtherCATsociety, where `SOEM` itself is also hosted?
The main benefit is we wouldn't be depen…
-
I have compiled my example by such pass pipeline.
oec-opt --stencil-shape-inference --convert-stencil-to-std --cse --parallel-loop-tiling='parallel-loop-tile-sizes=128,1,1' --canonicalize --test-gpu-…
-
Currently, requests to Algorand and OKExChain relays return a chain not supported error despite them being monetized chains on Pocket.
-
Hi there,
We're hoping to use the Docker image of OEC.
It looks like the OEC Dockerfile is missing a version label however, and the OEC github repo doesn't as-of-yet use release tagging.
G…
Ray-B updated
3 years ago
-
@mikabr ... I happened up on this repo, since I had been researching some `ojs` and `quarto` stuff [here](https://github.com/quarto-dev/quarto-cli/discussions/6276).
I know `ojs` isn't used so much…
-
Hi there, I have been recently working on integrating new OpsGenie OEC connector with Icinga2 container and faced couple of things that I have decided to ask you about. OEC connector is using python3 …
-
First off, what is the structure of the data and what is the range of values? Second how would we want to visualize this? As another view of the product space?
I think we would also need some copy ex…
-
There is a difference in the ´date´ attribute between :
https://staging.oec.world/api/story (correct)
and
https://staging.oec.world/api/story/bottlenecks-in-the-fertilizer-industry-are-a-threat-to…