search

Alan-Collins / CRISPR_comparison_toolkit

Tools to analyze the differences and similarities between CRISPR arrays
GNU General Public License v3.0
8 stars 2 forks source link

Please, add your repeat sequence. #1

Closed ntinamu001 closed 2 years ago

ntinamu001 commented 2 years ago

We discovered that the CRISPR subtype repeats from the P.inopinatus are not included in your default database.

Here, CRISPR repeat sequence information (direction is confirmed).

GTTTTAGAAGAGTGTCGAATCAATATAGTTAAGATC

Also, some of the repeat mutant sequence (Marked with bold)

GTTTTAGAAGAGTGTCGAATCAATATAGTTAATGAG

GTTTTAGAAGAGTGTCGAATCAATATAGTTAAAATC

ACCTTCAAAGAGTGTCGAATCAATATAGTTAAGATC

GTTCTAGAAGAGTGTCGAATCAATATAGTTAAGATC

I also attached a figure to illustrate the sequence difference above. image

If you add my subtypes to the database it will be helpful for the analysis.

Best regards, Wooje

Alan-Collins commented 2 years ago

Thank you for contributing this repeat sequence! Added in 77b1e84

ntinamu001 commented 2 years ago

Thank you for contributing this repeat sequence! Added in 77b1e84

Thank you for the update. Wooje