search

AstraZeneca-NGS / VarDict

VarDict
MIT License
187 stars 62 forks source link

vardict cannot call this insertion #159

Closed cswph closed 3 years ago

cswph commented 3 years ago

Hi, I try to use vardict to call insertion at this this place ABXL:chr20:31022442. We used sample from seracare and it insert a 'G' at this position. I can also see there is insertion in IGV. Please see the attached picture.

WeChatb89cea4b2e018995d1839e06e45b8892

But when I ran the vardict with these parameters, -C -z -c 1 -S 2 -E 3 -g 4 -B 2 -v -f 0.005 -r 5 -m 8 -Q 60 -q 25 -X 10 -th 1 , it can only call the deletion, which much less than the insertion. So I tried different combination of the parameter settings and found that if I change the -q 10 I can successfully call it out. But when I check the base quality, the quality looks normal as the other bases. So could you help me to find out how it is filtered?

I also zip the bam file here. bam.zip

Thank you very much for the help!

PolinaBevad commented 3 years ago

Hi @cswph ,

It seems that both insertion and deletion must be on the same position, so did you try to run var2vcf_valid.pl step with -A option? By default we keep only the position with the highest AF.

cswph commented 3 years ago

Hi Polina, Thanks for the reply! I think var2vcf_valid.pl is the step after the VarDict. Out insertion is not even shown in the Vardict. And I try to use the simulated data, which include the insertion and deletion at this position, it can be called by Vardict. And the insertion has double amount of the deletion.

Thanks again

PolinaBevad commented 3 years ago

That's strange, because I see this insertion even with standard options: vardict.pl -G human_g1k_v37_decoy.fasta -c 1 -S 2 -E 3 -g 4 -b RD2019242FFP.new.bam -R chr20:31022400-31022500 it results in two variants on the position:

20      31022441        .       A       AG      204     PASS    SAMPLE=RD2019242FFP.new;TYPE=Insertion;DP=734;END=31022441;VD=52;AF=0.0708;BIAS=2:2;REFBIAS=356:221;VARBIAS=42:9;PMEAN=35.1;PSTD=1;QUAL=35.8;QSTD=1;SBF=0.00357;ODDRATIO=2.89276519424918;MQ=60;SN=104;HIAF=0.1161;ADJAF=0;SHIFT3=8;MSI=9;MSILEN=1;NM=0.4;HICNT=52;HICOV=448;LSEQ=GCGGCCACCACTGCCATCGG;RSEQ=GGGGGGGGTGGCCCGGGTGG;DUPRATE=0;SPLITREAD=0;SPANPAIR=0       GT:DP:VD:AD:AF:RD:ALD   0/1:734:52:577,52:0.0708:356,221:42,9
20      31022441        .       AG      A       158     PASS    SAMPLE=RD2019242FFP.new;TYPE=Deletion;DP=774;END=31022442;VD=21;AF=0.0271;BIAS=2:2;REFBIAS=433:318;VARBIAS=12:9;PMEAN=42.2;PSTD=1;QUAL=36;QSTD=0;SBF=1;ODDRATIO=1.02121;MQ=60;SN=42;HIAF=0.0282;ADJAF=0;SHIFT3=7;MSI=8;MSILEN=1;NM=0.5;HICNT=21;HICOV=745;LSEQ=GCGGCCACCACTGCCATCGG;RSEQ=GGGGGGGTGGCCCGGGTGGA;DUPRATE=0;SPLITREAD=0;SPANPAIR=0  GT:DP:VD:AD:AF:RD:ALD   0/1:774:21:751,21:0.0271:433,318:12,9

What version of VarDict do you use? I assume that you use Java program, as you set -th option (it works only in Java), please try to run with VarDict 1.7+ Options -v and -C are deprecated, so you can delete them from command line if you will use the new version.

cswph commented 3 years ago

OK, I will give it a try. Thank you!