search

AstraZeneca-NGS / VarDictJava

VarDict Java port
MIT License
128 stars 57 forks source link

A germline SNV called as somatic #312

Open Gerde opened 4 years ago

Gerde commented 4 years ago

Hi, Here I report a germline SNV which called as an somatic SNV. 

chr7    150556055       .       CG      GC      266     PASS    STATUS=Germline;SAMPLE=DN2003754SLZAA02;TYPE=Complex;DP=169;VD=157;AF=0.929;SHIFT3=0;MSI=1.000;MSILEN=1;SSF=0.00135;SOR=0;LSEQ=CCCCTGGGGCCACAAGCGCA;RSEQ=TACCGCCTGCAGATCCACTCGT:DP:VD:ALD:RD:AD:AF:BIAS:PMEAN:PSTD:QUAL:QSTD:SBF:ODDRATIO:MQ:SN:HIAF:ADJAF:NM        1/1:169:157:80,77:0,0:0,157:0.929:0,2:39.2:1:36.5:1:1:0:60:77.5:0.9451:0.0414:1.3       1/1:120:120:57,63:0,0:0,120:1:0,2:38.3:1:36.7:1:1:0:60:240:1:0.0583:1.4
chr7    150556055       .       C       G       103     PASS    STATUS=StrongSomatic;SAMPLE=DN2003754SLZAA02;TYPE=SNV;DP=169;VD=11;AF=0.0651;SHIFT3=0;MSI=1.000;MSILEN=1;SSF=0.00238;SOR=0;LSEQ=CCCCTGGGGCCACAAGCGCA;RSEQ=GTACCGCCTGCAGATCCACT       GT:DP:VD:ALD:RD:AD:AF:BIAS:PMEAN:PSTD:QUAL:QSTD:SBF:ODDRATIO:MQ:SN:HIAF:ADJAF:NM        0/1:169:11:5,6:0,0:0,11:0.0651:0,2:21.1:1:29.9:1:1:0:60:2.667:0.0488:0:2.5      0/0:120:0:0,0:0,0:0,0:0:0,0:0:0:0:0:1:0:0:0:0:0:0

chr7:150556055:C>G is obviously a germline SNV，but Vardict classified as StrongSomatic. snv

Here is my code and run with lasted Vardict(1.7.0):

VarDict -th 4 -G ucsc.hg19.fasta -N "TUMOR|NORMAL" -b "tumor.bam|normal.bam" -I 50 -r 6 -f 0.005 -U -c 1 -S 2 -E 3 -k 0 -X 0 -m 50 -q 15 test.bed | testsomatic.R | var2vcf_paired.pl -A -N "TUMOR|NORMAL" -f 0.005 -r 6 > out.vcf

And, I met an strange problem that, I got an empty (no variants) VCF when I run the code with extracted BAM files for chr7:150556055 from whole BAM file. I have attached the bam&bed files.

files.zip

Thanks!

Best, Gerde

PolinaBevad commented 4 years ago

Hi Gerde,

Sorry that you have the issue! I've checked and yes, it seems that this StrongSomatic variant is quite a strange artifact that appears when local realignment is disabled. I will investigate the reason and get back to you!

For the second part of your issue with chr7:150556055 region, please, try to run it as -R chr7:150556055-150556056, as we work with regions >= 1 nucleotides (as in BED standard, zero-based format with end excluded)!

worker000000 commented 3 years ago

@PolinaBevad has this been fixed, thanks a lot