search

AstraZeneca-NGS / VarDictJava

VarDict Java port
MIT License
127 stars 55 forks source link

variation different between Single Sample Mode and Single Sample Mode #356

Open wangxuedong930227 opened 2 years ago

wangxuedong930227 commented 2 years ago

I got a variation used Single Sample Mode, but when it is running Paired Variant Calling, the variation is not obtained.

The command of single sample mode is 'VarDict-1.6.0/bin/VarDict -G Homo_sapiens_assembly19.fasta -b sample.bam -f 0.00001 -z -c 1 -S 2 -E 3 -g 4 -th 8 -U -r 1 -B 1 pos.bed> vardict.out

The variants in single is : sample A 16 89883007 89883007 A T 6682 66 2248 3847 36 30 A/T 0.0099 2;2 33.1 1 30.4 1 60.0 3.125 0.0098 0 2 3.000 1 1.9 50 5123 GGCCCGAGGCGGAGTTCGGG CCCACGAGTCGGACATGGCC 16:89883007-89883007 SNV 0 0

Paired Sample Command only adds a pairing sample： -b "sample.bam|normal.bam"

PolinaBevad commented 2 years ago

Hi @wangxuedong930227, sorry for the late answer! Is it possible to check this on Vardict 1.8.2? 1.6.0 is quite old, we do not support it anymore.