search

AstraZeneca-NGS / VarDictJava

VarDict Java port
MIT License
128 stars 57 forks source link

Deletion is being called as complex variant #363

Open lk9-lnx opened 2 years ago

lk9-lnx commented 2 years ago

I'm trying to detect this deletion 'CGGAAACCGTAGCTGCCCTGGTAGGTTTTCTGGGAAG' in our sample that is present at 0.5 frequency in TP53 gene at chr17 7579358 position.

Vardict is not detecting this variant, but it identified a complex variant 'AACCGTAGCTGCCCTGGTAGGTTTTCTGGGAAGGGACA' at 7579362 position at 0.01 frequency.

/opt/VarDictJava/build/install/VarDict/bin/VarDict -G genome.fa \ -th 4 -k 1 -p -q 15 -o 1.3 -f 0.01 -N ${case} -b ${case}.bam \ -c 1 -S 2 -E 3 -g 4 abc.bed \ | teststrandbias.R | var2vcf_valid.pl -N ${case} -q 15 -E -f 0.01 > ${case}.vcf

I also tried with -X 0, but the deletion is not detected by Vardict.

Do you have suggestions?

PolinaBevad commented 2 years ago

Hi @lk9-lnx , What are the variants that called when you run -X 0? The same complex or other variants? And can you please check first the raw output of vardict (i.e. before teststrandbias.R script).

lk9-lnx commented 2 years ago

Hi @PolinaBevad - thank you for the message. I'm seeing the same result with -X 0 and also in the raw output of Vardict. The deletion is not being detected. attached igv screenshot here.

deletion2