Open jimroll opened 8 years ago
Example failing query:
CUCAGUAUAGAACCGCUCAGUACGGAACCGCUCAGUACGGAACUG
There is still a gap between what we accept as a hairpin loop and what we reject as a full sequence without a secondary structure. For example the input:
CUCAGUAUAGAACCGCUCACGCGUUUG
Does not submit or display the "please check your input" message. Also, is it possible to make the error messages for bad input more informative?
long RNAs with no secondary structure do not provide an error or submit. error messages when given could give more information. can someone who is better with javascript tackle this one?