Feature Request: bowtie2-explain command

[jamesbraza]

Background

I am new to the world of bioinformatics, and am trying to interpret the output of bowtie2-align:

57  0   16  14186687    255 23M *   0   0   AGAGAGTTAAGGGCTTACAGCGG IIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1  MD:Z:16C6   YT:Z:UU
764 0   9   23643676    255 23M *   0   0   AGTGATGAAAGACTTTAAAGAGG IIIIIIIIIIIIIIIIIIIIIII AS:i:-6 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1  MD:Z:16C6   YT:Z:UU

I am using Sequence Alignment/Map Format Specification v1.

I am having to one-by-one look up stuff like AS, XN, XM, etc. Again, note that I am a total beginner here.

Request

It would be cool to create a command bowtie2-explain that one could pass this file to, and have it explain the meaning of everything. For example, print a brief summary of what MD:Z:16C6 or AS:i:-6 means.

Thank you for your consideration!