Saw ASCII character 10 but expected 33-based Phred qual. Aborted (core dumped)

BenLangmead / bowtie2

A fast and sensitive gapped read aligner

GNU General Public License v3.0

639 stars 159 forks source link

Saw ASCII character 10 but expected 33-based Phred qual. Aborted (core dumped) #423

Open TeddyLee1 opened 1 year ago

TeddyLee1 commented 1 year ago

When I only use humann2 software for metagenomics analysis, I encountered an error report, but I don't know what caused it. I hope that teachers can help me solve this problem. （Error message returned from metaphlan2.py : Saw ASCII character 10 but expected 33-based Phred qual. Aborted (core dumped) (ERR): bowtie2-align exited with value 134 Error while running bowtie2.)****

ch4rr0 commented 1 year ago

Hello, and sorry for the late response on this. It is possible that there are some extra newlines in your FASTA/Q record that is tripping up the Bowtie 2 parser. Bowtie2 is very strict about this and record like the one below can cause this error:

@r1
ACGTGCGTCTTCGTCTTTTGAGCTACCTTTT
+

IIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

ch4rr0 commented 9 months ago

Hello,

We have pushed a couple of commits to bug_fixes that should take care of this issue. With this change even the below FASTQ file gets parsed without error:


@r1

CTGTCTCGACGTTTAAAGGCATTCAAGCCTAGAATTACACCATAATT

+

IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@r2

CTGTCTCGACGTTTAAAGGCATTCAAGCCTAGAATTACACCATAATT

+

IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

@r3

+

xmy1990 commented 5 months ago

hello, @https://github.com/ch4rr0 which version of bowtie2 have you add the above bug_fixes ?

thanks!

ch4rr0 commented 5 months ago

Hello,

I have not published a release with the fixes yet. v2.5.3 should be coming out before the end of the week.

xmy1990 commented 5 months ago

@https://github.com/ch4rr0 Thank you, I eagerly look forward to your updates.