Bioconductor / Contributions

Contribute Packages to Bioconductor
135 stars 33 forks source link

DNAfusion #2759

Closed CTrierMaansson closed 2 years ago

CTrierMaansson commented 2 years ago

Update the following URL to point to the GitHub repository of the package you wish to submit to Bioconductor

Confirm the following by editing each check box to '[x]'

I am familiar with the essential aspects of Bioconductor software management, including:

For questions/help about the submission process, including questions about the output of the automatic reports generated by the SPB (Single Package Builder), please use the #package-submission channel of our Community Slack. Follow the link on the home page of the Bioconductor website to sign up.

bioc-issue-bot commented 2 years ago

Hi @CTrierMaansson

Thanks for submitting your package. We are taking a quick look at it and you will hear back from us soon.

The DESCRIPTION file for this package is:

Package: DNAfusion
Title: Identification of gene fusions using paired-end sequencing
Version: 0.99.0
biocViews: TargetedResequencing, Genetics, GeneFusionDetection, Sequencing
Authors@R: 
    c(person(given = "Christoffer Trier", family = "Maansson", , email = "ctm@clin.au.dk", role = c("aut", "cre"),
 comment = c(ORCID = "0000-0002-3071-3437")),
    person(given = "Emma Roger", family = "Andersen", , email = "201907412@post.au.dk", role = c("ctb", "rev")),
    person(given = "Maiken Parm", family = "Ulhoi", , email = "maiken@oncology.au.dk", role = "dtc"),
    person(given = "Peter", family = "Meldgaard", , email = "petemeld@rm.dk", role = "dtc"),
    person(given = "Boe Sandahl", family = "Sorensen", , email = "b.sorensen@clin.au.dk", role = c("rev", "fnd")))
Description: Paired-end sequencing of cfDNA generated BAM files can be used as input to
  discover EML4-ALK variants. This package was developed using position deduplicated BAM
  files generated with the AVENIO Oncology Analysis Software. These files are made using
  the AVENIO ctDNA surveillance kit and Illumina Nextseq 500 sequencing. This is a targeted 
  hybridization NGS approach and includes ALK-specific but not EML4-specific probes. 
License: GPL-3
Encoding: UTF-8
Roxygen: list(markdown = TRUE)
RoxygenNote: 7.2.1
Suggests: 
    knitr,
    rmarkdown,
    usethis,
    devtools,
    testthat,
    BiocStyle,
    sessioninfo
VignetteBuilder: knitr
Imports:
 bamsignals,
  GenomicRanges,
  IRanges,
  Rsamtools
Depends:
  dplyr,
  R (>= 4.2.0)
BugReports: https://github.com/CTrierMaansson/DNAfusion/issues
URL: https://github.com/CTrierMaansson/DNAfusion
vjcitn commented 2 years ago

Thanks for this submission. I think

head(EML4_ALK_detection(file = H3122_bam, 
                        genome = "hg38", 
                        mates = 2))
#>          pos cigar     mpos
#> 726 42299657 94M2S 29223691
#> 727 42299657 94M2S 29223375
#> 728 42299657 94M2S 29223479
#> 729 42299657 94M2S 29223686
#> 731 42299657 94M2S 29223636
#> 733 42299657 94M2S 29223687
#>                                                                                                  seq
#> 726 TTGCTTCTTTCACTTAGTTTTTTTTGTTTTGTTTTGTTTGTTTGTTTTTTGAGATGGGGTTTCACTCTTGTTGCCCAGGCTGGAGTGCAGTGGTCT
#> 727 TTGCTTCTTTCACTTAGTTTTTTTTGTTTTGTTTTGTTTGTTTGTTTTTTGAGATGGGGTTTCACTCTTGTTGCCCAGGCTGGAGTGCAGTGGTCT
#> 728 TTGCTTCTTTCACTTAGTTTTTTTTGTTTTGTTTTGTTTGTTTGTTTTTTGAGATGGGGTTTCACTCTTGTTGCCCAGGCTGGAGTGCAGTGGTCT
#> 729 TTGCTTCTTTCACTTAGTTTTTTTTGTTTTGTTTTGTTTGTTTGTTTTTTGAGATGGGGTTTCACTCTTGTTGCCCAGGCTGGAGTGCAGTGGTCT
#> 731 TTGCTTCTTTCACTTAGTTTTTTTTGTTTTGTTTTGTTTGTTTGTTTTTTGAGATGGGGTTTCACTCTTGTTGCCCAGGCTGGAGTGCAGTGGTCT
#> 733 TTGCTTCTTTCACTTAGTTTTTTTTGTTTTGTTTTGTTTGTTTGTTTTTTGAGATGGGGTTTCACTCTTGTTGCCC

should not be a data frame but an instance of a class deriving from GenomicAlignments. Would you have a look at GenomicAlignments package? I think the Bioconductor representations may be advantageous.

CTrierMaansson commented 2 years ago

Hello

Hello I have changed the output of EML4_ALK_detection() to a GAlingments object. Futhermore, I have made the appropriate changes to the other functions, as well as the documentation.

I have changed this at my GitHub repository, however I'm unsuccefull in pushing the update to git@git.bioconductor.org:packages/DNAfusion.git. Am I doing something wrong?

Kind regards Christoffer

vjcitn commented 2 years ago

be sure to read the FAQ about git pushing issues and consider pushing to https://github.com/bioconductor.org/packages/DNAfusion

LiNk-NY commented 2 years ago

Hi Christoffer @CTrierMaansson and Vince @vjcitn I believe once the package passes the 1. Awaiting Moderation stage, it will be added to the Bioconductor git server. Lori can confirm this @lshep Best, Marcel

vjcitn commented 2 years ago

Oh, right, I have to change the labels once I look at the revisions. Thanks @LiNk-NY !!

vjcitn commented 2 years ago

Even when it gets to "pre-check passed" there is a manual ingestion step needed.

CTrierMaansson commented 2 years ago

I'm sorry. Do I need to do anything? or do I need to wait until @vjcitn changes the labels?

LiNk-NY commented 2 years ago

I'm sorry. Do I need to do anything? or do I need to wait until @vjcitn changes the labels?

Hi Christoffer, @CTrierMaansson You do not need to do anything. We are a little backed up and your package will be ingested soon. Best, Marcel

bioc-issue-bot commented 2 years ago

A reviewer has been assigned to your package. Learn what to expect during the review process.

IMPORTANT: Please read this documentation for setting up remotes to push to git.bioconductor.org. It is required to push a version bump to git.bioconductor.org to trigger a new build.

Bioconductor utilized your github ssh-keys for git.bioconductor.org access. To manage keys and future access you may want to active your Bioconductor Git Credentials Account

bioc-issue-bot commented 2 years ago

Dear Package contributor,

This is the automated single package builder at bioconductor.org.

Your package has been built on Linux, Mac, and Windows.

Congratulations! The package built without errors or warnings on all platforms.

Please see the build report for more details. This link will be active for 21 days.

Remember: if you submitted your package after July 7th, 2020, when making changes to your repository push to git@git.bioconductor.org:packages/DNAfusion to trigger a new build. A quick tutorial for setting up remotes and pushing to upstream can be found here.

LiNk-NY commented 2 years ago

Hi Christoffer, @CTrierMaansson Thank you for the submission. Sorry for the delay. Please see the review below. Feel free to post any questions. Best, Marcel


DNAfusion #2759

DESCRIPTION

NAMESPACE

vignettes

R

test

> covr::package_coverage()
DNAfusion Coverage: 87.07%
R/DNAfusion_functions.R: 87.07%
bioc-issue-bot commented 2 years ago

Received a valid push on git.bioconductor.org; starting a build for commit id: 019031e00f8f0ab3a06446d083db041837057844

bioc-issue-bot commented 2 years ago

Dear Package contributor,

This is the automated single package builder at bioconductor.org.

Your package has been built on Linux, Mac, and Windows.

Congratulations! The package built without errors or warnings on all platforms.

Please see the build report for more details. This link will be active for 21 days.

Remember: if you submitted your package after July 7th, 2020, when making changes to your repository push to git@git.bioconductor.org:packages/DNAfusion to trigger a new build. A quick tutorial for setting up remotes and pushing to upstream can be found here.

CTrierMaansson commented 2 years ago

Dear Marcel

Thank you for the review!

DNAfusion #2759

Description

  1. Are usethis and devtools needed in the Suggests?

vignettes

  1. Avoid the code duplication and assign the output of EML4_ALK_detection to a variable(s) and re-use.

R

  1. Avoid using numeric indices and use named indices, e.g., 3 in index_helper.
  1. Return an empty GAlignments() instead of the message "No EML4-ALK was detected" in EML4_ALK_detection and check any downstream results with isEmpty().
  1. Optional. Minor. Consider using BiocBaseUtils for type checking e.g., with isScalarCharacter.

test

  1. It's great that you have tests. 100% coverage is quite feasible, I think.
LiNk-NY commented 2 years ago

Hi Christoffer, @CTrierMaansson

Thank you for making those changes. One, minor follow up:

  • devtools::session_info is used in the vignettes and devtools is therefore in Suggests

devtoools points to sessioninfo so it is better to simply add sessioninfo to the Suggests field.

The package looks to be in good shape for acceptance. Best regards, Marcel

bioc-issue-bot commented 2 years ago

Received a valid push on git.bioconductor.org; starting a build for commit id: c977f353f69bd2bb8f0d8c4f960df35cbf2d4290

CTrierMaansson commented 2 years ago

Hi Marcel, @LiNk-NY

Thank you!

  1. devtoools points to sessioninfo so it is better to simply add sessioninfo to the Suggests field.

Best regards

Christoffer

bioc-issue-bot commented 2 years ago

Dear Package contributor,

This is the automated single package builder at bioconductor.org.

Your package has been built on Linux, Mac, and Windows.

Congratulations! The package built without errors or warnings on all platforms.

Please see the build report for more details. This link will be active for 21 days.

Remember: if you submitted your package after July 7th, 2020, when making changes to your repository push to git@git.bioconductor.org:packages/DNAfusion to trigger a new build. A quick tutorial for setting up remotes and pushing to upstream can be found here.

bioc-issue-bot commented 2 years ago

Your package has been accepted. It will be added to the Bioconductor nightly builds.

Thank you for contributing to Bioconductor!

Reviewers for Bioconductor packages are volunteers from the Bioconductor community. If you are interested in becoming a Bioconductor package reviewer, please see Reviewers Expectations.

lshep commented 2 years ago

The master branch of your GitHub repository has been added to Bioconductor's git repository.

To use the git.bioconductor.org repository, we need an 'ssh' key to associate with your github user name. If your GitHub account already has ssh public keys (https://github.com/CTrierMaansson.keys is not empty), then no further steps are required. Otherwise, do the following:

  1. Add an SSH key to your github account
  2. Submit your SSH key to Bioconductor

See further instructions at

https://bioconductor.org/developers/how-to/git/

for working with this repository. See especially

https://bioconductor.org/developers/how-to/git/new-package-workflow/ https://bioconductor.org/developers/how-to/git/sync-existing-repositories/

to keep your GitHub and Bioconductor repositories in sync.

Your package will be included in the next nigthly 'devel' build (check-out from git at about 6 pm Eastern; build completion around 2pm Eastern the next day) at

https://bioconductor.org/checkResults/

(Builds sometimes fail, so ensure that the date stamps on the main landing page are consistent with the addition of your package). Once the package builds successfully, you package will be available for download in the 'Devel' version of Bioconductor using BiocManager::install("DNAfusion"). The package 'landing page' will be created at

https://bioconductor.org/packages/DNAfusion

If you have any questions, please contact the bioc-devel mailing list (https://stat.ethz.ch/mailman/listinfo/bioc-devel); this issue will not be monitored further.

lshep commented 2 years ago

We had an issue processing packages -- I'm temporarily reopening so I can reprocess and get your package on the daily builders. Sorry for any confusion and delay

bioc-issue-bot commented 2 years ago

Dear @CTrierMaansson ,

We have reopened the issue to continue the review process. Please remember to push a version bump to git.bioconductor.org to trigger a new build.

lshep commented 2 years ago

The master branch of your GitHub repository has been added to Bioconductor's git repository.

To use the git.bioconductor.org repository, we need an 'ssh' key to associate with your github user name. If your GitHub account already has ssh public keys (https://github.com/CTrierMaansson.keys is not empty), then no further steps are required. Otherwise, do the following:

  1. Add an SSH key to your github account
  2. Submit your SSH key to Bioconductor

See further instructions at

https://bioconductor.org/developers/how-to/git/

for working with this repository. See especially

https://bioconductor.org/developers/how-to/git/new-package-workflow/ https://bioconductor.org/developers/how-to/git/sync-existing-repositories/

to keep your GitHub and Bioconductor repositories in sync.

Your package will be included in the next nigthly 'devel' build (check-out from git at about 6 pm Eastern; build completion around 2pm Eastern the next day) at

https://bioconductor.org/checkResults/

(Builds sometimes fail, so ensure that the date stamps on the main landing page are consistent with the addition of your package). Once the package builds successfully, you package will be available for download in the 'Devel' version of Bioconductor using BiocManager::install("DNAfusion"). The package 'landing page' will be created at

https://bioconductor.org/packages/DNAfusion

If you have any questions, please contact the bioc-devel mailing list (https://stat.ethz.ch/mailman/listinfo/bioc-devel); this issue will not be monitored further.