Closed pmjklemm closed 1 year ago
I used a sequence with a known promotor sequence test2.fna:
>SMc01022_inside GGAATACGTCGCCCCATAACGCTTTGCCGGCTGTCCGGCCAAATGGCGAATCGACCGGGCGAAAGCGAATAAAAACGAGGCCGCGGGCGTCTAATCGGAGACGCTCTACCATCACGTAGACGTACGCGCCGGGCGTCGGAGTCTGCCATGCTGCGCAAC
this contains the promotor sequence of SMc01022 (https://journals.asm.org/doi/pdf/10.1128/mSphereDirect.00454-18, Table 1, first row) I added 60nt up and downstream.
python promotech.py -pg -m RF-HOT -f test2.fna -o results
next predict:
python promotech.py -g -t 0.6 -i results -o results
the output prints one promotor (good) but hot-encoded:
(...) SEQ: 0100010010001000000110000010010000010010010000100010001000101000000110001000001001000010000100010001010000100010010001000010000101000001001000100100010000100010 PREDICTION: 0.1105 (...)
please add a final decoding step. And results/genome_predictions.csv is empty.
Full output: predict.log.txt
nevermind, the output is just empty with -t 0.6 my bad
-t 0.6
I used a sequence with a known promotor sequence test2.fna:
this contains the promotor sequence of SMc01022 (https://journals.asm.org/doi/pdf/10.1128/mSphereDirect.00454-18, Table 1, first row) I added 60nt up and downstream.
python promotech.py -pg -m RF-HOT -f test2.fna -o results
next predict:
python promotech.py -g -t 0.6 -i results -o results
the output prints one promotor (good) but hot-encoded:
please add a final decoding step. And results/genome_predictions.csv is empty.
Full output: predict.log.txt