Could I keep the I1&R1&R2.fastq.gz as their original format after the extraction?

[yuw444]

It seems to me that the format fastq file has been changed, is there any way I can keep their original format after extraction.

Before: R1:

@ST-K00126:308:HFLYFBBXX:1:1101:31345:1261 1:N:0:NACCACCA
AACTCTTGTTCTGAACCGGTTGGGAT
+
AAFFFJJJJJJJJJJJJJJJJJJJJJ

R2:

@ST-K00126:308:HFLYFBBXX:1:1101:31345:1261 2:N:0:NACCACCA
CCTTTTTGGAACCAACAATAGCAGCTCCATTTCTGGAGTCTGGGTCTTCCGAGGCCAGGAGCTCGCCTTTCCGCCGAGCCCAGATTGGCAGGTGGACT
+
A<<AFAFFFJJJJFJJJFA<7<FJF-AAJF7-FFF<FA7AFFFJ-77<JJFFFJJJJFAJFJ7-7AJ-7-FJJJ--)7-77F-F--AAAJAA-7-7F7

After extraction:

R1:

@ST-K00126:308:HFLYFBBXX:1:1101:31345:1261_AACTCTTGTTCTGAAC_CGGTTGGGAT 1:N:0:NACCACCA

+

R2:

@ST-K00126:308:HFLYFBBXX:1:1101:31345:1261_AACTCTTGTTCTGAAC_CGGTTGGGAT 2:N:0:NACCACCA
CCTTTTTGGAACCAACAATAGCAGCTCCATTTCTGGAGTCTGGGTCTTCCGAGGCCAGGAGCTCGCCTTTCCGCCGAGCCCAGATTGGCAGGTGGACT
+
A<<AFAFFFJJJJFJJJFA<7<FJF-AAJF7-FFF<FA7AFFFJ-77<JJFFFJJJJFAJFJ7-7AJ-7-FJJJ--)7-77F-F--AAAJAA-7-7F7

I saw CBs has been added in the topline after extraction in R2.filtered.fastq.gz, I could manually put their back to R1.filtered.fastq.gz file. However, the reading quality line has been deleted after extraction in R1.filtered.fastq.gz.

In my setting, I have to put the filtered.fastq.gz back to cellranger pipeline.

Please help.

Thanks so much.

[TomSmithCGAT]

Hi @yuw444 - I'm a bit confused by that example. The two reads shown are not the same 25834:1173 vs 31345:1261 in the fastq 'header' lines.

[yuw444]

@TomSmithCGAT, sorry for the confusion. I have updated the question above.

The coding scheme(format) of R1 and R2 after extraction may benefit the pipeline. But cellranger will complain if I feed them into cellranger pipeline. So, I was thinking put the filtered R1, R2 back into cellranger pipeline to keep the consistency of my project, as I used cellranger pipeline for UMI counts.

[IanSudbery]

Probably easiest if instead of putting the sequence back in the R1, you discard the processed R1, and rebuild it with the sequence intact from the unprocessed file.

[yuw444]

Thanks for your suggestion.